Incidental Mutation 'R6263:Ccdc141'
ID506796
Institutional Source Beutler Lab
Gene Symbol Ccdc141
Ensembl Gene ENSMUSG00000044033
Gene Namecoiled-coil domain containing 141
SynonymsENSMUSG00000075261, 2610301F02Rik, CAMDI
MMRRC Submission
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R6263 (G1)
Quality Score225.009
Status Validated
Chromosome2
Chromosomal Location77009902-77170636 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 77108463 bp
ZygosityHeterozygous
Amino Acid Change Glutamine to Arginine at position 266 (Q266R)
Ref Sequence ENSEMBL: ENSMUSP00000052945 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000049544] [ENSMUST00000164114]
Predicted Effect noncoding transcript
Transcript: ENSMUST00000028406
Predicted Effect probably damaging
Transcript: ENSMUST00000049544
AA Change: Q266R

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000052945
Gene: ENSMUSG00000044033
AA Change: Q266R

DomainStartEndE-ValueType
SPEC 26 128 2.87e-1 SMART
Blast:SPEC 132 222 1e-40 BLAST
low complexity region 223 251 N/A INTRINSIC
SPEC 252 353 3.61e-1 SMART
Blast:SPEC 356 453 2e-49 BLAST
Blast:SPEC 461 562 1e-16 BLAST
low complexity region 569 583 N/A INTRINSIC
Blast:SPEC 688 772 7e-30 BLAST
low complexity region 773 785 N/A INTRINSIC
Blast:SPEC 790 894 2e-24 BLAST
Blast:SPEC 907 1009 4e-44 BLAST
Blast:SPEC 1012 1118 9e-63 BLAST
low complexity region 1203 1231 N/A INTRINSIC
Blast:IG 1305 1416 5e-54 BLAST
SCOP:d1g1ca_ 1406 1443 1e-9 SMART
Blast:IG 1416 1444 2e-9 BLAST
Predicted Effect noncoding transcript
Transcript: ENSMUST00000131660
Predicted Effect probably benign
Transcript: ENSMUST00000164114
AA Change: Q266R

PolyPhen 2 Score 0.231 (Sensitivity: 0.91; Specificity: 0.88)
SMART Domains Protein: ENSMUSP00000128736
Gene: ENSMUSG00000044033
AA Change: Q266R

DomainStartEndE-ValueType
SPEC 26 128 2.87e-1 SMART
Blast:SPEC 132 222 2e-40 BLAST
low complexity region 223 251 N/A INTRINSIC
SPEC 252 353 3.61e-1 SMART
Blast:SPEC 356 453 2e-49 BLAST
Blast:SPEC 461 562 1e-16 BLAST
low complexity region 569 583 N/A INTRINSIC
Blast:SPEC 688 772 7e-30 BLAST
low complexity region 773 785 N/A INTRINSIC
Blast:SPEC 790 894 3e-24 BLAST
Blast:SPEC 907 1009 4e-44 BLAST
Blast:SPEC 1012 1118 1e-62 BLAST
low complexity region 1203 1231 N/A INTRINSIC
IGc2 1422 1489 1.27e-5 SMART
transmembrane domain 1510 1529 N/A INTRINSIC
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.7%
  • 10x: 98.4%
  • 20x: 95.7%
Validation Efficiency 97% (66/68)
MGI Phenotype PHENOTYPE: Homozygous knockout impairs migration of neurons in the somatosensory cortex, resulting in increased anxiety and hyperactivity. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 67 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4931423N10Rik T A 2: 23,266,733 probably benign Het
4932438A13Rik T A 3: 36,931,111 N863K probably benign Het
Ahnak A G 19: 9,018,277 I5642V probably benign Het
Atp5a1 A G 18: 77,779,230 probably null Het
Bsn A T 9: 108,113,254 F1766L probably damaging Het
Cdh10 T A 15: 18,964,068 D105E possibly damaging Het
Clca3a1 T A 3: 144,749,778 D418V probably damaging Het
Cnnm2 C A 19: 46,856,905 T612K probably benign Het
Col3a1 T C 1: 45,321,575 V55A unknown Het
Cpd A C 11: 76,846,271 D232E probably benign Het
Csde1 A G 3: 103,040,017 H95R probably benign Het
Ctcfl T A 2: 173,095,337 H596L probably benign Het
Cwc22 T C 2: 77,896,171 R855G possibly damaging Het
Cwc25 A G 11: 97,753,227 Y227H probably damaging Het
Cyp2c38 G A 19: 39,392,215 P409S probably damaging Het
Ddx5 A G 11: 106,788,313 S2P possibly damaging Het
Dnah2 C A 11: 69,457,412 G2570W probably damaging Het
Dnajc10 T A 2: 80,343,948 V528E probably damaging Het
Fmo1 A G 1: 162,850,060 probably null Het
Gm11639 G A 11: 104,919,486 D3150N unknown Het
Gpatch1 C A 7: 35,303,423 D221Y probably damaging Het
Ino80 T C 2: 119,383,414 Y1225C probably damaging Het
Itga7 T A 10: 128,944,086 D501E probably benign Het
Lgr4 T C 2: 110,011,898 S743P possibly damaging Het
Lilra5 A T 7: 4,238,361 Y99F probably damaging Het
Lmna A G 3: 88,502,958 V49A probably damaging Het
Lrrc72 G A 12: 36,208,604 R267* probably null Het
Mapkbp1 T C 2: 120,023,291 S1199P probably damaging Het
Mmp25 G A 17: 23,630,794 A541V possibly damaging Het
Myh10 A T 11: 68,810,232 N1756Y probably damaging Het
Nfe2 A G 15: 103,250,951 I31T probably damaging Het
Nfe2l1 A T 11: 96,817,744 F732I probably benign Het
Olfr1238 C G 2: 89,406,730 M116I possibly damaging Het
Olfr1255 T A 2: 89,816,760 C145S probably damaging Het
Olfr603 C A 7: 103,383,196 V269F possibly damaging Het
Pax6 T C 2: 105,692,854 probably null Het
Phb A G 11: 95,678,115 E192G probably damaging Het
Plekhn1 A T 4: 156,225,193 probably null Het
Plxnb2 A T 15: 89,161,986 V942E probably damaging Het
Rsrc2 G A 5: 123,739,688 probably benign Het
Sept8 G A 11: 53,548,383 C460Y probably benign Het
Slc13a2 CGTTATCTGT CGT 11: 78,403,480 probably benign Het
Slc16a7 A G 10: 125,294,639 I59T probably benign Het
Slc35d1 A T 4: 103,208,168 I172N possibly damaging Het
Smg5 A T 3: 88,341,901 N40Y possibly damaging Het
Smurf1 A G 5: 144,881,731 V633A probably damaging Het
Snx9 T C 17: 5,887,049 V22A probably damaging Het
Sox6 A T 7: 115,477,060 M741K probably damaging Het
Spata31d1d T C 13: 59,725,983 Q1246R probably benign Het
Sval1 A G 6: 41,951,726 E24G probably damaging Het
Tas2r124 A G 6: 132,754,904 I59V probably benign Het
Tmem151b T A 17: 45,547,066 T85S probably benign Het
Tpr T A 1: 150,442,245 probably null Het
Trpm6 A C 19: 18,854,108 T1446P possibly damaging Het
Tsc22d4 A T 5: 137,768,179 K502N possibly damaging Het
Tssk3 C T 4: 129,489,258 S207N probably benign Het
Ttbk1 G T 17: 46,467,262 P618Q probably damaging Het
Ttll6 A T 11: 96,156,545 M657L probably benign Het
Ubash3a T A 17: 31,215,095 I138N probably benign Het
Ush2a A G 1: 188,358,642 Y490C probably damaging Het
Vmn1r82 G T 7: 12,305,534 V127F probably damaging Het
Vmn2r32 A T 7: 7,476,692 S161T possibly damaging Het
Wdr49 T C 3: 75,481,517 I58M possibly damaging Het
Wiz A T 17: 32,360,443 probably null Het
Wrap53 A T 11: 69,562,793 Y324* probably null Het
Zfp747 A C 7: 127,375,966 probably benign Het
Zfp827 A G 8: 79,179,073 Y33C probably damaging Het
Other mutations in Ccdc141
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00517:Ccdc141 APN 2 77054644 missense probably damaging 0.98
IGL01396:Ccdc141 APN 2 77128325 missense possibly damaging 0.87
IGL01408:Ccdc141 APN 2 77045679 missense probably benign 0.01
IGL01633:Ccdc141 APN 2 77089249 missense probably benign 0.01
IGL01982:Ccdc141 APN 2 77030659 missense probably damaging 1.00
IGL02105:Ccdc141 APN 2 77049577 critical splice donor site probably null
IGL02307:Ccdc141 APN 2 77029342 missense probably damaging 1.00
IGL02645:Ccdc141 APN 2 77074867 nonsense probably null
IGL02737:Ccdc141 APN 2 77057924 missense probably damaging 0.97
IGL02740:Ccdc141 APN 2 77054609 missense probably benign 0.05
IGL02949:Ccdc141 APN 2 77027594 missense probably damaging 1.00
IGL03127:Ccdc141 APN 2 77029235 critical splice donor site probably null
Verloren UTSW 2 77027648 missense probably damaging 1.00
Verschied UTSW 2 77108356 splice site probably benign
R0153:Ccdc141 UTSW 2 77165238 intron probably benign
R0384:Ccdc141 UTSW 2 77027648 missense probably damaging 1.00
R0423:Ccdc141 UTSW 2 77039450 missense probably damaging 0.96
R0573:Ccdc141 UTSW 2 77039493 missense probably benign 0.00
R1332:Ccdc141 UTSW 2 77014440 missense probably damaging 1.00
R1336:Ccdc141 UTSW 2 77014440 missense probably damaging 1.00
R1355:Ccdc141 UTSW 2 77030601 missense probably damaging 1.00
R1416:Ccdc141 UTSW 2 77014796 missense probably damaging 1.00
R1659:Ccdc141 UTSW 2 77054683 missense probably benign 0.41
R1726:Ccdc141 UTSW 2 77108356 splice site probably benign
R1799:Ccdc141 UTSW 2 77011671 missense possibly damaging 0.88
R1837:Ccdc141 UTSW 2 77011665 missense probably benign 0.00
R1839:Ccdc141 UTSW 2 77011665 missense probably benign 0.00
R1918:Ccdc141 UTSW 2 77014703 missense probably benign 0.00
R2019:Ccdc141 UTSW 2 77011565 missense probably damaging 1.00
R2133:Ccdc141 UTSW 2 77059607 missense probably benign 0.28
R2158:Ccdc141 UTSW 2 77030671 missense probably damaging 1.00
R2256:Ccdc141 UTSW 2 77132262 missense probably damaging 1.00
R2359:Ccdc141 UTSW 2 77170402 missense probably damaging 1.00
R2382:Ccdc141 UTSW 2 77011542 missense probably damaging 1.00
R2382:Ccdc141 UTSW 2 77074998 missense probably benign 0.11
R3110:Ccdc141 UTSW 2 77039486 missense probably benign 0.31
R3112:Ccdc141 UTSW 2 77039486 missense probably benign 0.31
R4334:Ccdc141 UTSW 2 77170432 missense probably damaging 1.00
R4493:Ccdc141 UTSW 2 77132297 missense probably damaging 1.00
R4494:Ccdc141 UTSW 2 77132297 missense probably damaging 1.00
R4628:Ccdc141 UTSW 2 77059680 missense probably benign 0.02
R4748:Ccdc141 UTSW 2 77057980 missense possibly damaging 0.67
R4810:Ccdc141 UTSW 2 77045755 missense possibly damaging 0.73
R4824:Ccdc141 UTSW 2 77124336 missense probably damaging 0.99
R4829:Ccdc141 UTSW 2 77074916 missense probably damaging 0.99
R4920:Ccdc141 UTSW 2 77168563 missense probably damaging 1.00
R5024:Ccdc141 UTSW 2 77054703 missense probably benign 0.17
R5073:Ccdc141 UTSW 2 77124378 splice site probably null
R5251:Ccdc141 UTSW 2 77027774 missense probably damaging 1.00
R5252:Ccdc141 UTSW 2 77132249 missense probably benign 0.03
R5534:Ccdc141 UTSW 2 77057897 missense probably benign
R5539:Ccdc141 UTSW 2 77015093 missense probably damaging 0.98
R5551:Ccdc141 UTSW 2 77014409 missense probably damaging 1.00
R5784:Ccdc141 UTSW 2 77029327 missense probably damaging 1.00
R5837:Ccdc141 UTSW 2 77108437 missense possibly damaging 0.56
R5850:Ccdc141 UTSW 2 77029403 missense probably damaging 0.98
R6050:Ccdc141 UTSW 2 77011731 missense probably benign 0.33
R6502:Ccdc141 UTSW 2 77170401 missense probably damaging 1.00
R6580:Ccdc141 UTSW 2 77011755 missense possibly damaging 0.50
R6865:Ccdc141 UTSW 2 77029235 critical splice donor site probably null
R7014:Ccdc141 UTSW 2 77132297 missense probably damaging 1.00
R7094:Ccdc141 UTSW 2 77041453 missense possibly damaging 0.83
R7195:Ccdc141 UTSW 2 77049583 missense probably benign 0.39
R7300:Ccdc141 UTSW 2 77014694 missense probably benign 0.00
R7654:Ccdc141 UTSW 2 77042478 missense probably benign 0.05
R7834:Ccdc141 UTSW 2 77059545 missense possibly damaging 0.81
R7868:Ccdc141 UTSW 2 77108412 missense probably damaging 0.99
R7917:Ccdc141 UTSW 2 77059545 missense possibly damaging 0.81
R7951:Ccdc141 UTSW 2 77108412 missense probably damaging 0.99
R8059:Ccdc141 UTSW 2 77044751 missense probably damaging 1.00
R8082:Ccdc141 UTSW 2 77124244 missense probably damaging 0.99
Z1088:Ccdc141 UTSW 2 77128272 missense probably benign 0.03
Z1177:Ccdc141 UTSW 2 77015149 missense probably benign 0.00
Predicted Primers PCR Primer
(F):5'- AACGCTCTAGTGATCATTTCTATGC -3'
(R):5'- TTGCCCTTAAGCATTGAGAGG -3'

Sequencing Primer
(F):5'- TGCAATCTGTAAATGACTCAGCC -3'
(R):5'- TTAAGCATTGAGAGGCTGAAATAAAG -3'
Posted On2018-03-15