Incidental Mutation 'R6263:Cnnm2'
ID506858
Institutional Source Beutler Lab
Gene Symbol Cnnm2
Ensembl Gene ENSMUSG00000064105
Gene Namecyclin M2
SynonymsAcdp2
MMRRC Submission
Accession Numbers

Genbank: NM_033569; MGI: 2151054

Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R6263 (G1)
Quality Score225.009
Status Validated
Chromosome19
Chromosomal Location46761596-46878795 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) C to A at 46856905 bp
ZygosityHeterozygous
Amino Acid Change Threonine to Lysine at position 612 (T612K)
Ref Sequence ENSEMBL: ENSMUSP00000096972 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000077666] [ENSMUST00000099373]
Predicted Effect probably benign
Transcript: ENSMUST00000077666
AA Change: T612K

PolyPhen 2 Score 0.298 (Sensitivity: 0.91; Specificity: 0.89)
SMART Domains Protein: ENSMUSP00000076850
Gene: ENSMUSG00000064105
AA Change: T612K

DomainStartEndE-ValueType
low complexity region 28 39 N/A INTRINSIC
low complexity region 41 54 N/A INTRINSIC
low complexity region 56 67 N/A INTRINSIC
low complexity region 194 227 N/A INTRINSIC
Pfam:DUF21 257 431 7.8e-39 PFAM
Blast:CBS 455 505 3e-14 BLAST
Pfam:CBS 514 578 7.6e-6 PFAM
Blast:cNMP 649 805 2e-49 BLAST
Predicted Effect probably benign
Transcript: ENSMUST00000099373
AA Change: T612K

PolyPhen 2 Score 0.298 (Sensitivity: 0.91; Specificity: 0.89)
SMART Domains Protein: ENSMUSP00000096972
Gene: ENSMUSG00000064105
AA Change: T612K

DomainStartEndE-ValueType
low complexity region 28 39 N/A INTRINSIC
low complexity region 41 54 N/A INTRINSIC
low complexity region 56 67 N/A INTRINSIC
low complexity region 194 227 N/A INTRINSIC
Pfam:DUF21 257 431 2.6e-39 PFAM
Blast:CBS 455 505 3e-14 BLAST
Pfam:CBS 514 578 1.1e-5 PFAM
Blast:cNMP 649 827 1e-46 BLAST
Meta Mutation Damage Score 0.1129 question?
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.7%
  • 10x: 98.4%
  • 20x: 95.7%
Validation Efficiency 97% (66/68)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of the ancient conserved domain containing protein family. Members of this protein family contain a cyclin box motif and have structural similarity to the cyclins. The encoded protein may play an important role in magnesium homeostasis by mediating the epithelial transport and renal reabsorption of Mg2+. Mutations in this gene are associated with renal hypomagnesemia. Alternatively spliced transcript variants encoding multiple isoforms have been observed for this gene. [provided by RefSeq, Dec 2011]
Allele List at MGI

All alleles(90) : Gene trapped(90)

Other mutations in this stock
Total: 67 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4931423N10Rik T A 2: 23,266,733 probably benign Het
4932438A13Rik T A 3: 36,931,111 N863K probably benign Het
Ahnak A G 19: 9,018,277 I5642V probably benign Het
Atp5a1 A G 18: 77,779,230 probably null Het
Bsn A T 9: 108,113,254 F1766L probably damaging Het
Ccdc141 T C 2: 77,108,463 Q266R probably damaging Het
Cdh10 T A 15: 18,964,068 D105E possibly damaging Het
Clca3a1 T A 3: 144,749,778 D418V probably damaging Het
Col3a1 T C 1: 45,321,575 V55A unknown Het
Cpd A C 11: 76,846,271 D232E probably benign Het
Csde1 A G 3: 103,040,017 H95R probably benign Het
Ctcfl T A 2: 173,095,337 H596L probably benign Het
Cwc22 T C 2: 77,896,171 R855G possibly damaging Het
Cwc25 A G 11: 97,753,227 Y227H probably damaging Het
Cyp2c38 G A 19: 39,392,215 P409S probably damaging Het
Ddx5 A G 11: 106,788,313 S2P possibly damaging Het
Dnah2 C A 11: 69,457,412 G2570W probably damaging Het
Dnajc10 T A 2: 80,343,948 V528E probably damaging Het
Fmo1 A G 1: 162,850,060 probably null Het
Gm11639 G A 11: 104,919,486 D3150N unknown Het
Gpatch1 C A 7: 35,303,423 D221Y probably damaging Het
Ino80 T C 2: 119,383,414 Y1225C probably damaging Het
Itga7 T A 10: 128,944,086 D501E probably benign Het
Lgr4 T C 2: 110,011,898 S743P possibly damaging Het
Lilra5 A T 7: 4,238,361 Y99F probably damaging Het
Lmna A G 3: 88,502,958 V49A probably damaging Het
Lrrc72 G A 12: 36,208,604 R267* probably null Het
Mapkbp1 T C 2: 120,023,291 S1199P probably damaging Het
Mmp25 G A 17: 23,630,794 A541V possibly damaging Het
Myh10 A T 11: 68,810,232 N1756Y probably damaging Het
Nfe2 A G 15: 103,250,951 I31T probably damaging Het
Nfe2l1 A T 11: 96,817,744 F732I probably benign Het
Olfr1238 C G 2: 89,406,730 M116I possibly damaging Het
Olfr1255 T A 2: 89,816,760 C145S probably damaging Het
Olfr603 C A 7: 103,383,196 V269F possibly damaging Het
Pax6 T C 2: 105,692,854 probably null Het
Phb A G 11: 95,678,115 E192G probably damaging Het
Plekhn1 A T 4: 156,225,193 probably null Het
Plxnb2 A T 15: 89,161,986 V942E probably damaging Het
Rsrc2 G A 5: 123,739,688 probably benign Het
Sept8 G A 11: 53,548,383 C460Y probably benign Het
Slc13a2 CGTTATCTGT CGT 11: 78,403,480 probably benign Het
Slc16a7 A G 10: 125,294,639 I59T probably benign Het
Slc35d1 A T 4: 103,208,168 I172N possibly damaging Het
Smg5 A T 3: 88,341,901 N40Y possibly damaging Het
Smurf1 A G 5: 144,881,731 V633A probably damaging Het
Snx9 T C 17: 5,887,049 V22A probably damaging Het
Sox6 A T 7: 115,477,060 M741K probably damaging Het
Spata31d1d T C 13: 59,725,983 Q1246R probably benign Het
Sval1 A G 6: 41,951,726 E24G probably damaging Het
Tas2r124 A G 6: 132,754,904 I59V probably benign Het
Tmem151b T A 17: 45,547,066 T85S probably benign Het
Tpr T A 1: 150,442,245 probably null Het
Trpm6 A C 19: 18,854,108 T1446P possibly damaging Het
Tsc22d4 A T 5: 137,768,179 K502N possibly damaging Het
Tssk3 C T 4: 129,489,258 S207N probably benign Het
Ttbk1 G T 17: 46,467,262 P618Q probably damaging Het
Ttll6 A T 11: 96,156,545 M657L probably benign Het
Ubash3a T A 17: 31,215,095 I138N probably benign Het
Ush2a A G 1: 188,358,642 Y490C probably damaging Het
Vmn1r82 G T 7: 12,305,534 V127F probably damaging Het
Vmn2r32 A T 7: 7,476,692 S161T possibly damaging Het
Wdr49 T C 3: 75,481,517 I58M possibly damaging Het
Wiz A T 17: 32,360,443 probably null Het
Wrap53 A T 11: 69,562,793 Y324* probably null Het
Zfp747 A C 7: 127,375,966 probably benign Het
Zfp827 A G 8: 79,179,073 Y33C probably damaging Het
Other mutations in Cnnm2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00493:Cnnm2 APN 19 46763220 missense probably damaging 1.00
IGL01971:Cnnm2 APN 19 46871676 missense probably benign 0.19
IGL02003:Cnnm2 APN 19 46868559 missense probably damaging 1.00
IGL02068:Cnnm2 APN 19 46877388 missense possibly damaging 0.94
IGL02185:Cnnm2 APN 19 46762995 missense probably benign 0.45
IGL02652:Cnnm2 APN 19 46763211 missense probably damaging 1.00
IGL02682:Cnnm2 APN 19 46762076 missense probably benign 0.37
IGL03009:Cnnm2 APN 19 46877355 missense probably damaging 1.00
IGL03378:Cnnm2 APN 19 46878034 missense possibly damaging 0.76
R1581:Cnnm2 UTSW 19 46763123 missense probably damaging 0.99
R3700:Cnnm2 UTSW 19 46762551 missense probably damaging 1.00
R3892:Cnnm2 UTSW 19 46761793 nonsense probably null
R3911:Cnnm2 UTSW 19 46877936 missense probably damaging 0.96
R4508:Cnnm2 UTSW 19 46877270 missense probably benign 0.01
R4678:Cnnm2 UTSW 19 46763246 missense possibly damaging 0.91
R4878:Cnnm2 UTSW 19 46859083 missense probably benign 0.45
R5154:Cnnm2 UTSW 19 46763132 missense probably benign 0.02
R5445:Cnnm2 UTSW 19 46877288 missense possibly damaging 0.66
R5771:Cnnm2 UTSW 19 46856995 splice site probably null
R5914:Cnnm2 UTSW 19 46763177 missense probably benign 0.07
R6715:Cnnm2 UTSW 19 46853973 missense probably damaging 1.00
R6881:Cnnm2 UTSW 19 46877219 missense probably damaging 1.00
R7022:Cnnm2 UTSW 19 46762550 missense probably damaging 0.98
R7022:Cnnm2 UTSW 19 46858940 splice site probably null
R7486:Cnnm2 UTSW 19 46762074 missense possibly damaging 0.94
R7600:Cnnm2 UTSW 19 46762067 missense probably benign 0.02
R7648:Cnnm2 UTSW 19 46877900 missense probably damaging 0.98
R7800:Cnnm2 UTSW 19 46877981 missense probably benign 0.28
R8867:Cnnm2 UTSW 19 46762557 missense probably damaging 0.99
X0017:Cnnm2 UTSW 19 46762463 missense probably benign 0.05
X0018:Cnnm2 UTSW 19 46762773 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- GTTCTGGAGGGATTCTAGCAC -3'
(R):5'- ATGCCGACACTGAACACAGG -3'

Sequencing Primer
(F):5'- GGATTCTAGCACCGTTTGAAACAGC -3'
(R):5'- ACACAAAGTGGCATTACTTGTC -3'
Posted On2018-03-15