Mutagenetix > Incidental Mutation

Incidental Mutation 'R6310:Gbf1'

509566

Institutional Source

Beutler Lab

Gene Symbol

Gbf1

Ensembl Gene

ENSMUSG00000025224

Gene Name

golgi-specific brefeldin A-resistance factor 1

Synonyms

1700083E03Rik

MMRRC Submission

Accession Numbers

Essential gene?

Essential (E-score: 1.000) question?

Stock #

R6310 (G1)

Quality Score

225.009

Status

Not validated

Chromosome

Chromosomal Location

46152509-46286510 bp(+) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

A to G at 46280005 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Histidine to Arginine at position 1272 (H1272R)

Ref Sequence

ENSEMBL: ENSMUSP00000135062 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000026254] [ENSMUST00000175747] [ENSMUST00000176992]

AlphaFold

Q6DFZ1

Predicted Effect

possibly damaging
Transcript: ENSMUST00000026254
AA Change: H1326R

PolyPhen 2 Score 0.568 (Sensitivity: 0.88; Specificity: 0.91)

SMART Domains

Protein: ENSMUSP00000026254
Gene: ENSMUSG00000025224
AA Change: H1326R

Domain	Start	End	E-Value	Type
low complexity region	270	288	N/A	INTRINSIC
Pfam:Sec7_N	400	551	3.4e-29	PFAM
Sec7	696	884	8.55e-91	SMART
low complexity region	1198	1216	N/A	INTRINSIC
low complexity region	1281	1296	N/A	INTRINSIC
low complexity region	1773	1793	N/A	INTRINSIC
low complexity region	1802	1820	N/A	INTRINSIC

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000175706

Predicted Effect

probably benign
Transcript: ENSMUST00000175747

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000175878

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000176046

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000176525

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000176576

Predicted Effect

probably damaging
Transcript: ENSMUST00000176992
AA Change: H1272R

PolyPhen 2 Score 0.957 (Sensitivity: 0.78; Specificity: 0.95)

SMART Domains

Protein: ENSMUSP00000135062
Gene: ENSMUSG00000025224
AA Change: H1272R

Domain	Start	End	E-Value	Type
low complexity region	216	234	N/A	INTRINSIC
Pfam:Sec7_N	343	498	1.5e-35	PFAM
Sec7	642	830	8.55e-91	SMART
low complexity region	1144	1162	N/A	INTRINSIC
low complexity region	1227	1242	N/A	INTRINSIC
low complexity region	1715	1735	N/A	INTRINSIC
low complexity region	1744	1762	N/A	INTRINSIC

Coding Region Coverage

1x: 100.0%
3x: 99.9%
10x: 99.2%
20x: 97.5%

Validation Efficiency

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of the Sec7 domain family. The encoded protein is a guanine nucleotide exchange factor that regulates the recruitment of proteins to membranes by mediating GDP to GTP exchange. The encoded protein is localized to the Golgi apparatus and plays a role in vesicular trafficking by activating ADP ribosylation factor 1. The encoded protein has also been identified as an important host factor for viral replication. Multiple transcript variants have been observed for this gene. [provided by RefSeq, Dec 2010]

Allele List at MGI

Other mutations in this stock

Total: 53 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
Acly	C	G	11: 100,482,220	G856A	possibly damaging	Het
Adgrb3	T	A	1: 25,111,718	M1145L	probably benign	Het
Akap13	A	T	7: 75,749,193	H2673L	probably damaging	Het
Bmpr1b	A	G	3: 141,864,536	S131P	probably damaging	Het
Cep72	A	C	13: 74,053,025	S175A	possibly damaging	Het
Chd2	C	T	7: 73,453,164	E1358K	probably damaging	Het
Cmip	T	C	8: 117,429,810	I308T	possibly damaging	Het
Cps1	A	T	1: 67,142,981	N118I	probably benign	Het
Cux1	C	T	5: 136,275,164	G1265D	probably benign	Het
Ddx24	C	A	12: 103,423,907	R275L	probably damaging	Het
Dhx58	T	C	11: 100,699,367	S364G	probably benign	Het
Dis3l	A	C	9: 64,322,575	V274G	probably benign	Het
Fryl	A	T	5: 73,191,761		probably benign	Het
Gjb3	A	G	4: 127,326,640	V33A	probably damaging	Het
Gm11595	G	A	11: 99,772,555	R100C	unknown	Het
Gm9964	T	C	11: 79,296,650		probably benign	Het
Grk5	T	C	19: 61,080,911	I342T	probably damaging	Het
Hnf1b	T	A	11: 83,904,911	C527S	probably damaging	Het
Hoxd4	G	T	2: 74,728,390	A186S	possibly damaging	Het
Ighv1-78	G	A	12: 115,868,964	H54Y	probably benign	Het
Intu	T	A	3: 40,701,291	L936*	probably null	Het
Kcp	G	A	6: 29,493,258	R89W	probably damaging	Het
Kctd3	T	C	1: 188,972,238	T779A	probably benign	Het
Muc16	G	A	9: 18,641,950	P4349L	probably benign	Het
Nedd9	T	C	13: 41,318,452	T178A	probably benign	Het
Nuak2	G	T	1: 132,329,961	A204S	probably damaging	Het
Olfr566	T	A	7: 102,857,205	I26F	probably benign	Het
Olfr807	T	C	10: 129,754,659	R264G	probably benign	Het
Pcdhac2	C	A	18: 37,145,771	Y601*	probably null	Het
Pla2g4a	T	A	1: 149,842,226	D624V	possibly damaging	Het
Plxnb1	T	C	9: 109,109,728	V1386A	probably damaging	Het
Plxnd1	T	A	6: 115,976,736	L623F	possibly damaging	Het
Pms2	T	A	5: 143,923,583	S71R	probably benign	Het
Prkg1	T	C	19: 30,569,251	D683G	probably damaging	Het
Rasgrp3	T	A	17: 75,494,209	Y45N	probably damaging	Het
Rfc4	T	C	16: 23,114,709	I233M	probably benign	Het
Sema3a	G	A	5: 13,557,019	G274S	probably damaging	Het
Sesn1	T	C	10: 41,896,078	L201P	probably damaging	Het
Setx	G	A	2: 29,176,935	V2363I	possibly damaging	Het
Sh3glb1	A	G	3: 144,697,467	S81P	probably damaging	Het
Sik3	A	G	9: 46,178,486	S218G	probably damaging	Het
Slc12a2	C	G	18: 57,915,506	F781L	probably damaging	Het
Slc12a6	A	T	2: 112,335,839	I188F	probably damaging	Het
Slc34a2	A	G	5: 53,064,797		probably null	Het
Slc35f4	A	G	14: 49,322,457	C44R	probably damaging	Het
Sytl1	G	A	4: 133,260,998	P16S	probably benign	Het
Taok3	C	T	5: 117,255,938	T592M	possibly damaging	Het
Tgfb1i1	T	C	7: 128,252,837	F303L	probably damaging	Het
Txk	T	C	5: 72,736,417	S7G	probably benign	Het
Utp4	T	C	8: 106,918,621	V550A	probably benign	Het
Vmn1r229	G	A	17: 20,814,714	D74N	probably benign	Het
Zfp638	A	G	6: 83,867,230	D25G	possibly damaging	Het
Zfp646	T	C	7: 127,883,907	V1752A	probably benign	Het

Other mutations in Gbf1

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00585:Gbf1	APN	19	46284249	critical splice acceptor site	probably null
IGL00988:Gbf1	APN	19	46284120	critical splice donor site	probably null
IGL01352:Gbf1	APN	19	46265215	missense	probably damaging	1.00
IGL01432:Gbf1	APN	19	46279995	missense	probably damaging	1.00
IGL01469:Gbf1	APN	19	46279364	missense	probably damaging	1.00
IGL01870:Gbf1	APN	19	46285669	missense	probably benign	0.00
IGL02019:Gbf1	APN	19	46279292	missense	possibly damaging	0.93
IGL02061:Gbf1	APN	19	46279258	missense	possibly damaging	0.65
IGL02126:Gbf1	APN	19	46252117	missense	probably damaging	0.97
IGL02272:Gbf1	APN	19	46269803	missense	probably damaging	1.00
IGL02346:Gbf1	APN	19	46285930	missense	probably damaging	1.00
IGL02491:Gbf1	APN	19	46262540	unclassified	probably benign
IGL03003:Gbf1	APN	19	46255655	missense	probably damaging	1.00
IGL03130:Gbf1	APN	19	46267348	missense	possibly damaging	0.82
IGL03376:Gbf1	APN	19	46262521	missense	possibly damaging	0.94
PIT4651001:Gbf1	UTSW	19	46163543	missense	probably benign
R0107:Gbf1	UTSW	19	46284828	missense	probably benign
R0139:Gbf1	UTSW	19	46261792	missense	probably damaging	1.00
R0180:Gbf1	UTSW	19	46285722	missense	probably benign
R0255:Gbf1	UTSW	19	46254110	splice site	probably benign
R0317:Gbf1	UTSW	19	46254020	missense	probably benign
R0329:Gbf1	UTSW	19	46272270	critical splice donor site	probably null
R0372:Gbf1	UTSW	19	46285704	missense	probably benign
R0666:Gbf1	UTSW	19	46262544	unclassified	probably benign
R1463:Gbf1	UTSW	19	46271545	unclassified	probably benign
R1701:Gbf1	UTSW	19	46261675	missense	probably damaging	1.00
R1848:Gbf1	UTSW	19	46272037	missense	possibly damaging	0.90
R1962:Gbf1	UTSW	19	46267219	missense	probably damaging	1.00
R1965:Gbf1	UTSW	19	46271564	missense	probably damaging	1.00
R1966:Gbf1	UTSW	19	46271564	missense	probably damaging	1.00
R2177:Gbf1	UTSW	19	46265670	missense	probably benign
R2238:Gbf1	UTSW	19	46163618	missense	probably benign
R2239:Gbf1	UTSW	19	46163618	missense	probably benign
R2520:Gbf1	UTSW	19	46265367	missense	probably benign
R3821:Gbf1	UTSW	19	46264807	missense	probably damaging	0.99
R4681:Gbf1	UTSW	19	46280550	missense	probably benign	0.41
R4695:Gbf1	UTSW	19	46259167	nonsense	probably null
R4785:Gbf1	UTSW	19	46268395	missense	possibly damaging	0.89
R5202:Gbf1	UTSW	19	46268454	missense	probably benign	0.13
R5359:Gbf1	UTSW	19	46283725	critical splice donor site	probably null
R5468:Gbf1	UTSW	19	46284296	missense	possibly damaging	0.92
R5593:Gbf1	UTSW	19	46272524	missense	possibly damaging	0.91
R5595:Gbf1	UTSW	19	46284422	missense	possibly damaging	0.74
R5796:Gbf1	UTSW	19	46284343	missense	probably benign	0.08
R5938:Gbf1	UTSW	19	46268452	missense	probably damaging	1.00
R5957:Gbf1	UTSW	19	46246221	critical splice donor site	probably null
R6059:Gbf1	UTSW	19	46265248	missense	probably damaging	1.00
R6120:Gbf1	UTSW	19	46279321	missense	possibly damaging	0.83
R6239:Gbf1	UTSW	19	46259696	missense	probably benign	0.00
R6252:Gbf1	UTSW	19	46271556	missense	probably benign	0.33
R6787:Gbf1	UTSW	19	46271772	missense	probably benign
R6805:Gbf1	UTSW	19	46262507	missense	probably damaging	1.00
R6855:Gbf1	UTSW	19	46279941	missense	probably benign	0.00
R7313:Gbf1	UTSW	19	46280354	missense	possibly damaging	0.94
R7414:Gbf1	UTSW	19	46283358	nonsense	probably null
R7646:Gbf1	UTSW	19	46283672	missense	probably damaging	1.00
R7650:Gbf1	UTSW	19	46272539	missense	probably damaging	1.00
R7789:Gbf1	UTSW	19	46254002	missense	probably damaging	1.00
R7801:Gbf1	UTSW	19	46272643	missense	probably benign	0.03
R8241:Gbf1	UTSW	19	46246137	missense	probably damaging	1.00
R8716:Gbf1	UTSW	19	46284021	missense	probably damaging	1.00
R8851:Gbf1	UTSW	19	46268483	missense	probably damaging	1.00
R9424:Gbf1	UTSW	19	46259683	missense	probably benign	0.00
R9435:Gbf1	UTSW	19	46279993	missense	probably benign	0.42
R9500:Gbf1	UTSW	19	46269950	missense	probably benign	0.01
R9567:Gbf1	UTSW	19	46271607	missense
R9576:Gbf1	UTSW	19	46259683	missense	probably benign	0.00
R9642:Gbf1	UTSW	19	46270268	missense	probably benign	0.00
R9680:Gbf1	UTSW	19	46283398	missense	probably damaging	0.96
R9760:Gbf1	UTSW	19	46255698	missense	probably benign	0.02
Z1177:Gbf1	UTSW	19	46259142	missense	probably damaging	0.98

Predicted Primers

PCR Primer
(F):5'- GCCAAAGTAAGCCAGACATG -3'
(R):5'- GGAGTTATCAATGTCATCCTTCCC -3'

Sequencing Primer
(F):5'- AGAAGACGCTAGGCCTCAGC -3'
(R):5'- GTCATCCTTCCCCACCTATAAAATAC -3'

Posted On

2018-04-02