Mutagenetix > Incidental Mutations

Incidental Mutation 'R2177:Gbf1'

236973

Institutional Source

Beutler Lab

Gene Symbol

Gbf1

Ensembl Gene

ENSMUSG00000025224

Gene Name

golgi-specific brefeldin A-resistance factor 1

Synonyms

1700083E03Rik

MMRRC Submission

040179-MU

Accession Numbers

Is this an essential gene?

Essential (E-score: 1.000) question?

Stock #

R2177 (G1)

Quality Score

225

Status

Validated

Chromosome

Chromosomal Location

46152509-46286510 bp(+) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

T to C at 46265670 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Serine to Proline at position 599 (S599P)

Ref Sequence

ENSEMBL: ENSMUSP00000135062 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000026254] [ENSMUST00000176992]

AlphaFold

Q6DFZ1

Predicted Effect

probably benign
Transcript: ENSMUST00000026254
AA Change: S653P

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)

SMART Domains

Protein: ENSMUSP00000026254
Gene: ENSMUSG00000025224
AA Change: S653P

Domain	Start	End	E-Value	Type
low complexity region	270	288	N/A	INTRINSIC
Pfam:Sec7_N	400	551	3.4e-29	PFAM
Sec7	696	884	8.55e-91	SMART
low complexity region	1198	1216	N/A	INTRINSIC
low complexity region	1281	1296	N/A	INTRINSIC
low complexity region	1773	1793	N/A	INTRINSIC
low complexity region	1802	1820	N/A	INTRINSIC

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000130184

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000176422

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000176853

Predicted Effect

probably benign
Transcript: ENSMUST00000176992
AA Change: S599P

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)

SMART Domains

Protein: ENSMUSP00000135062
Gene: ENSMUSG00000025224
AA Change: S599P

Domain	Start	End	E-Value	Type
low complexity region	216	234	N/A	INTRINSIC
Pfam:Sec7_N	343	498	1.5e-35	PFAM
Sec7	642	830	8.55e-91	SMART
low complexity region	1144	1162	N/A	INTRINSIC
low complexity region	1227	1242	N/A	INTRINSIC
low complexity region	1715	1735	N/A	INTRINSIC
low complexity region	1744	1762	N/A	INTRINSIC

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000177406

Predicted Effect

probably benign
Transcript: ENSMUST00000177512

Meta Mutation Damage Score

0.0898

Coding Region Coverage

1x: 99.2%
3x: 98.7%
10x: 97.5%
20x: 95.7%

Validation Efficiency

97% (60/62)

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of the Sec7 domain family. The encoded protein is a guanine nucleotide exchange factor that regulates the recruitment of proteins to membranes by mediating GDP to GTP exchange. The encoded protein is localized to the Golgi apparatus and plays a role in vesicular trafficking by activating ADP ribosylation factor 1. The encoded protein has also been identified as an important host factor for viral replication. Multiple transcript variants have been observed for this gene. [provided by RefSeq, Dec 2010]

Allele List at MGI

Other mutations in this stock

Total: 56 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
2310003L06Rik	T	A	5: 87,972,453	N356K	probably damaging	Het
Acap2	C	T	16: 31,133,528		probably null	Het
Adamts19	T	C	18: 58,954,554	L552P	possibly damaging	Het
Adamts2	T	A	11: 50,777,228	M539K	probably damaging	Het
Aplp1	A	T	7: 30,442,521	C210*	probably null	Het
Apoa1	A	T	9: 46,230,073	K156*	probably null	Het
AW551984	G	A	9: 39,599,815	R159C	probably benign	Het
Bok	C	T	1: 93,695,065	Q112*	probably null	Het
Cfap57	T	G	4: 118,606,688	I323L	probably benign	Het
Cfap69	T	A	5: 5,625,803	E270D	probably damaging	Het
Ch25h	G	T	19: 34,474,697	L144M	probably damaging	Het
Clcn6	T	A	4: 148,014,600	I429F	possibly damaging	Het
Cpb1	T	A	3: 20,266,447	T115S	probably benign	Het
Csf1r	T	A	18: 61,114,943		probably benign	Het
Ddx6	A	G	9: 44,627,731	T279A	probably damaging	Het
Dnah8	A	G	17: 30,653,393	H452R	probably benign	Het
Dscam	T	A	16: 96,610,324	D1784V	probably damaging	Het
Exo1	T	A	1: 175,882,890		probably null	Het
Fcho1	A	G	8: 71,712,261	S459P	probably damaging	Het
Fxyd4	C	T	6: 117,934,432	A56T	probably damaging	Het
Iqce	T	C	5: 140,691,593		probably benign	Het
Kat2a	A	G	11: 100,710,822	F256L	probably damaging	Het
Klk1b1	G	T	7: 43,969,271	R24L	possibly damaging	Het
Krtap16-1	A	G	11: 99,986,449	V43A	probably damaging	Het
Maea	C	G	5: 33,371,690	Q326E	probably benign	Het
Man1a2	A	T	3: 100,632,531	I308N	probably damaging	Het
Marf1	G	T	16: 14,152,607	R83S	probably benign	Het
Me3	A	C	7: 89,633,070	T54P	probably benign	Het
Mme	A	T	3: 63,301,005	I63L	probably benign	Het
Mmel1	A	G	4: 154,894,103	N664S	probably damaging	Het
Mrgprb2	A	G	7: 48,552,380	V199A	probably benign	Het
Mrpl36	T	A	13: 73,331,469	F33I	probably benign	Het
Nlrp4e	A	T	7: 23,355,261	T947S	probably benign	Het
Olfr297	G	A	7: 86,527,662	V302I	probably benign	Het
Olfr32	T	A	2: 90,138,464	H225L	possibly damaging	Het
Olfr922	A	T	9: 38,816,186	I228F	possibly damaging	Het
Parp4	A	T	14: 56,659,289	R1923S	unknown	Het
Pcm1	T	C	8: 41,275,965	V658A	probably benign	Het
Pkhd1l1	A	G	15: 44,459,395	S26G	probably benign	Het
Prom1	A	T	5: 44,026,739	H433Q	possibly damaging	Het
Rab7	T	C	6: 88,005,081	D104G	probably damaging	Het
Rabgap1l	A	G	1: 160,724,062	V282A	possibly damaging	Het
Rdh13	T	C	7: 4,427,667	E264G	possibly damaging	Het
Rock1	C	G	18: 10,070,263	R1270T	probably benign	Het
Sdhaf4	C	T	1: 23,996,289	G93R	probably damaging	Het
Sec24a	T	C	11: 51,704,401	T910A	probably benign	Het
Sesn1	A	G	10: 41,903,782	H345R	possibly damaging	Het
Snx4	T	A	16: 33,286,058		probably null	Het
Tchh	A	G	3: 93,444,132	E293G	unknown	Het
Tmem2	T	C	19: 21,811,785	S528P	possibly damaging	Het
Ulk2	T	A	11: 61,791,509	T727S	probably benign	Het
Usp53	T	C	3: 122,936,057	E756G	probably damaging	Het
Vmn2r68	G	A	7: 85,221,915	A720V	probably benign	Het
Vmn2r79	A	G	7: 86,996,631	N56S	possibly damaging	Het
Washc5	A	T	15: 59,363,269	Y263*	probably null	Het
Zfp119b	A	T	17: 55,938,639	C516S	probably damaging	Het

Other mutations in Gbf1

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00585:Gbf1	APN	19	46284249	critical splice acceptor site	probably null
IGL00988:Gbf1	APN	19	46284120	critical splice donor site	probably null
IGL01352:Gbf1	APN	19	46265215	missense	probably damaging	1.00
IGL01432:Gbf1	APN	19	46279995	missense	probably damaging	1.00
IGL01469:Gbf1	APN	19	46279364	missense	probably damaging	1.00
IGL01870:Gbf1	APN	19	46285669	missense	probably benign	0.00
IGL02019:Gbf1	APN	19	46279292	missense	possibly damaging	0.93
IGL02061:Gbf1	APN	19	46279258	missense	possibly damaging	0.65
IGL02126:Gbf1	APN	19	46252117	missense	probably damaging	0.97
IGL02272:Gbf1	APN	19	46269803	missense	probably damaging	1.00
IGL02346:Gbf1	APN	19	46285930	missense	probably damaging	1.00
IGL02491:Gbf1	APN	19	46262540	unclassified	probably benign
IGL03003:Gbf1	APN	19	46255655	missense	probably damaging	1.00
IGL03130:Gbf1	APN	19	46267348	missense	possibly damaging	0.82
IGL03376:Gbf1	APN	19	46262521	missense	possibly damaging	0.94
PIT4651001:Gbf1	UTSW	19	46163543	missense	probably benign
R0107:Gbf1	UTSW	19	46284828	missense	probably benign
R0139:Gbf1	UTSW	19	46261792	missense	probably damaging	1.00
R0180:Gbf1	UTSW	19	46285722	missense	probably benign
R0255:Gbf1	UTSW	19	46254110	splice site	probably benign
R0317:Gbf1	UTSW	19	46254020	missense	probably benign
R0329:Gbf1	UTSW	19	46272270	critical splice donor site	probably null
R0372:Gbf1	UTSW	19	46285704	missense	probably benign
R0666:Gbf1	UTSW	19	46262544	unclassified	probably benign
R1463:Gbf1	UTSW	19	46271545	unclassified	probably benign
R1701:Gbf1	UTSW	19	46261675	missense	probably damaging	1.00
R1848:Gbf1	UTSW	19	46272037	missense	possibly damaging	0.90
R1962:Gbf1	UTSW	19	46267219	missense	probably damaging	1.00
R1965:Gbf1	UTSW	19	46271564	missense	probably damaging	1.00
R1966:Gbf1	UTSW	19	46271564	missense	probably damaging	1.00
R2238:Gbf1	UTSW	19	46163618	missense	probably benign
R2239:Gbf1	UTSW	19	46163618	missense	probably benign
R2520:Gbf1	UTSW	19	46265367	missense	probably benign
R3821:Gbf1	UTSW	19	46264807	missense	probably damaging	0.99
R4681:Gbf1	UTSW	19	46280550	missense	probably benign	0.41
R4695:Gbf1	UTSW	19	46259167	nonsense	probably null
R4785:Gbf1	UTSW	19	46268395	missense	possibly damaging	0.89
R5202:Gbf1	UTSW	19	46268454	missense	probably benign	0.13
R5359:Gbf1	UTSW	19	46283725	critical splice donor site	probably null
R5468:Gbf1	UTSW	19	46284296	missense	possibly damaging	0.92
R5593:Gbf1	UTSW	19	46272524	missense	possibly damaging	0.91
R5595:Gbf1	UTSW	19	46284422	missense	possibly damaging	0.74
R5796:Gbf1	UTSW	19	46284343	missense	probably benign	0.08
R5938:Gbf1	UTSW	19	46268452	missense	probably damaging	1.00
R5957:Gbf1	UTSW	19	46246221	critical splice donor site	probably null
R6059:Gbf1	UTSW	19	46265248	missense	probably damaging	1.00
R6120:Gbf1	UTSW	19	46279321	missense	possibly damaging	0.83
R6239:Gbf1	UTSW	19	46259696	missense	probably benign	0.00
R6252:Gbf1	UTSW	19	46271556	missense	probably benign	0.33
R6310:Gbf1	UTSW	19	46280005	missense	probably damaging	0.96
R6787:Gbf1	UTSW	19	46271772	missense	probably benign
R6805:Gbf1	UTSW	19	46262507	missense	probably damaging	1.00
R6855:Gbf1	UTSW	19	46279941	missense	probably benign	0.00
R7313:Gbf1	UTSW	19	46280354	missense	possibly damaging	0.94
R7414:Gbf1	UTSW	19	46283358	nonsense	probably null
R7646:Gbf1	UTSW	19	46283672	missense	probably damaging	1.00
R7650:Gbf1	UTSW	19	46272539	missense	probably damaging	1.00
R7789:Gbf1	UTSW	19	46254002	missense	probably damaging	1.00
R7801:Gbf1	UTSW	19	46272643	missense	probably benign	0.03
R8241:Gbf1	UTSW	19	46246137	missense	probably damaging	1.00
R8716:Gbf1	UTSW	19	46284021	missense	probably damaging	1.00
R8851:Gbf1	UTSW	19	46268483	missense	probably damaging	1.00
R9424:Gbf1	UTSW	19	46259683	missense	probably benign	0.00
R9435:Gbf1	UTSW	19	46279993	missense	probably benign	0.42
Z1177:Gbf1	UTSW	19	46259142	missense	probably damaging	0.98

Predicted Primers

PCR Primer
(F):5'- TCCTATCAGAGCTAGCTAGTGTCC -3'
(R):5'- CTCTGGGGTTTAAGACAAGGTG -3'

Sequencing Primer
(F):5'- GTGTCCTATATAAGAACATGCAGCTC -3'
(R):5'- GAAGTGCTAGGGCTCTGC -3'

Posted On

2014-10-02