Incidental Mutation 'R2177:Gbf1'
ID236973
Institutional Source Beutler Lab
Gene Symbol Gbf1
Ensembl Gene ENSMUSG00000025224
Gene Namegolgi-specific brefeldin A-resistance factor 1
Synonyms1700083E03Rik
MMRRC Submission 040179-MU
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R2177 (G1)
Quality Score225
Status Validated
Chromosome19
Chromosomal Location46152509-46286510 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 46265670 bp
ZygosityHeterozygous
Amino Acid Change Serine to Proline at position 599 (S599P)
Ref Sequence ENSEMBL: ENSMUSP00000135062 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000026254] [ENSMUST00000176992]
Predicted Effect probably benign
Transcript: ENSMUST00000026254
AA Change: S653P

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
SMART Domains Protein: ENSMUSP00000026254
Gene: ENSMUSG00000025224
AA Change: S653P

DomainStartEndE-ValueType
low complexity region 270 288 N/A INTRINSIC
Pfam:Sec7_N 400 551 3.4e-29 PFAM
Sec7 696 884 8.55e-91 SMART
low complexity region 1198 1216 N/A INTRINSIC
low complexity region 1281 1296 N/A INTRINSIC
low complexity region 1773 1793 N/A INTRINSIC
low complexity region 1802 1820 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000130184
Predicted Effect noncoding transcript
Transcript: ENSMUST00000176422
Predicted Effect noncoding transcript
Transcript: ENSMUST00000176853
Predicted Effect probably benign
Transcript: ENSMUST00000176992
AA Change: S599P

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
SMART Domains Protein: ENSMUSP00000135062
Gene: ENSMUSG00000025224
AA Change: S599P

DomainStartEndE-ValueType
low complexity region 216 234 N/A INTRINSIC
Pfam:Sec7_N 343 498 1.5e-35 PFAM
Sec7 642 830 8.55e-91 SMART
low complexity region 1144 1162 N/A INTRINSIC
low complexity region 1227 1242 N/A INTRINSIC
low complexity region 1715 1735 N/A INTRINSIC
low complexity region 1744 1762 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000177406
Predicted Effect probably benign
Transcript: ENSMUST00000177512
Meta Mutation Damage Score 0.0898 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.7%
  • 10x: 97.5%
  • 20x: 95.7%
Validation Efficiency 97% (60/62)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of the Sec7 domain family. The encoded protein is a guanine nucleotide exchange factor that regulates the recruitment of proteins to membranes by mediating GDP to GTP exchange. The encoded protein is localized to the Golgi apparatus and plays a role in vesicular trafficking by activating ADP ribosylation factor 1. The encoded protein has also been identified as an important host factor for viral replication. Multiple transcript variants have been observed for this gene. [provided by RefSeq, Dec 2010]
Allele List at MGI
Other mutations in this stock
Total: 56 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2310003L06Rik T A 5: 87,972,453 N356K probably damaging Het
Acap2 C T 16: 31,133,528 probably null Het
Adamts19 T C 18: 58,954,554 L552P possibly damaging Het
Adamts2 T A 11: 50,777,228 M539K probably damaging Het
Aplp1 A T 7: 30,442,521 C210* probably null Het
Apoa1 A T 9: 46,230,073 K156* probably null Het
AW551984 G A 9: 39,599,815 R159C probably benign Het
Bok C T 1: 93,695,065 Q112* probably null Het
Cfap57 T G 4: 118,606,688 I323L probably benign Het
Cfap69 T A 5: 5,625,803 E270D probably damaging Het
Ch25h G T 19: 34,474,697 L144M probably damaging Het
Clcn6 T A 4: 148,014,600 I429F possibly damaging Het
Cpb1 T A 3: 20,266,447 T115S probably benign Het
Csf1r T A 18: 61,114,943 probably benign Het
Ddx6 A G 9: 44,627,731 T279A probably damaging Het
Dnah8 A G 17: 30,653,393 H452R probably benign Het
Dscam T A 16: 96,610,324 D1784V probably damaging Het
Exo1 T A 1: 175,882,890 probably null Het
Fcho1 A G 8: 71,712,261 S459P probably damaging Het
Fxyd4 C T 6: 117,934,432 A56T probably damaging Het
Iqce T C 5: 140,691,593 probably benign Het
Kat2a A G 11: 100,710,822 F256L probably damaging Het
Klk1b1 G T 7: 43,969,271 R24L possibly damaging Het
Krtap16-1 A G 11: 99,986,449 V43A probably damaging Het
Maea C G 5: 33,371,690 Q326E probably benign Het
Man1a2 A T 3: 100,632,531 I308N probably damaging Het
Marf1 G T 16: 14,152,607 R83S probably benign Het
Me3 A C 7: 89,633,070 T54P probably benign Het
Mme A T 3: 63,301,005 I63L probably benign Het
Mmel1 A G 4: 154,894,103 N664S probably damaging Het
Mrgprb2 A G 7: 48,552,380 V199A probably benign Het
Mrpl36 T A 13: 73,331,469 F33I probably benign Het
Nlrp4e A T 7: 23,355,261 T947S probably benign Het
Olfr297 G A 7: 86,527,662 V302I probably benign Het
Olfr32 T A 2: 90,138,464 H225L possibly damaging Het
Olfr922 A T 9: 38,816,186 I228F possibly damaging Het
Parp4 A T 14: 56,659,289 R1923S unknown Het
Pcm1 T C 8: 41,275,965 V658A probably benign Het
Pkhd1l1 A G 15: 44,459,395 S26G probably benign Het
Prom1 A T 5: 44,026,739 H433Q possibly damaging Het
Rab7 T C 6: 88,005,081 D104G probably damaging Het
Rabgap1l A G 1: 160,724,062 V282A possibly damaging Het
Rdh13 T C 7: 4,427,667 E264G possibly damaging Het
Rock1 C G 18: 10,070,263 R1270T probably benign Het
Sdhaf4 C T 1: 23,996,289 G93R probably damaging Het
Sec24a T C 11: 51,704,401 T910A probably benign Het
Sesn1 A G 10: 41,903,782 H345R possibly damaging Het
Snx4 T A 16: 33,286,058 probably null Het
Tchh A G 3: 93,444,132 E293G unknown Het
Tmem2 T C 19: 21,811,785 S528P possibly damaging Het
Ulk2 T A 11: 61,791,509 T727S probably benign Het
Usp53 T C 3: 122,936,057 E756G probably damaging Het
Vmn2r68 G A 7: 85,221,915 A720V probably benign Het
Vmn2r79 A G 7: 86,996,631 N56S possibly damaging Het
Washc5 A T 15: 59,363,269 Y263* probably null Het
Zfp119b A T 17: 55,938,639 C516S probably damaging Het
Other mutations in Gbf1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00585:Gbf1 APN 19 46284249 critical splice acceptor site probably null
IGL00988:Gbf1 APN 19 46284120 critical splice donor site probably null
IGL01352:Gbf1 APN 19 46265215 missense probably damaging 1.00
IGL01432:Gbf1 APN 19 46279995 missense probably damaging 1.00
IGL01469:Gbf1 APN 19 46279364 missense probably damaging 1.00
IGL01870:Gbf1 APN 19 46285669 missense probably benign 0.00
IGL02019:Gbf1 APN 19 46279292 missense possibly damaging 0.93
IGL02061:Gbf1 APN 19 46279258 missense possibly damaging 0.65
IGL02126:Gbf1 APN 19 46252117 missense probably damaging 0.97
IGL02272:Gbf1 APN 19 46269803 missense probably damaging 1.00
IGL02346:Gbf1 APN 19 46285930 missense probably damaging 1.00
IGL02491:Gbf1 APN 19 46262540 unclassified probably benign
IGL03003:Gbf1 APN 19 46255655 missense probably damaging 1.00
IGL03130:Gbf1 APN 19 46267348 missense possibly damaging 0.82
IGL03376:Gbf1 APN 19 46262521 missense possibly damaging 0.94
PIT4651001:Gbf1 UTSW 19 46163543 missense probably benign
R0107:Gbf1 UTSW 19 46284828 missense probably benign
R0139:Gbf1 UTSW 19 46261792 missense probably damaging 1.00
R0180:Gbf1 UTSW 19 46285722 missense probably benign
R0255:Gbf1 UTSW 19 46254110 splice site probably benign
R0317:Gbf1 UTSW 19 46254020 missense probably benign
R0329:Gbf1 UTSW 19 46272270 critical splice donor site probably null
R0372:Gbf1 UTSW 19 46285704 missense probably benign
R0666:Gbf1 UTSW 19 46262544 unclassified probably benign
R1463:Gbf1 UTSW 19 46271545 unclassified probably benign
R1701:Gbf1 UTSW 19 46261675 missense probably damaging 1.00
R1848:Gbf1 UTSW 19 46272037 missense possibly damaging 0.90
R1962:Gbf1 UTSW 19 46267219 missense probably damaging 1.00
R1965:Gbf1 UTSW 19 46271564 missense probably damaging 1.00
R1966:Gbf1 UTSW 19 46271564 missense probably damaging 1.00
R2238:Gbf1 UTSW 19 46163618 missense probably benign
R2239:Gbf1 UTSW 19 46163618 missense probably benign
R2520:Gbf1 UTSW 19 46265367 missense probably benign
R3821:Gbf1 UTSW 19 46264807 missense probably damaging 0.99
R4681:Gbf1 UTSW 19 46280550 missense probably benign 0.41
R4695:Gbf1 UTSW 19 46259167 nonsense probably null
R4785:Gbf1 UTSW 19 46268395 missense possibly damaging 0.89
R5202:Gbf1 UTSW 19 46268454 missense probably benign 0.13
R5359:Gbf1 UTSW 19 46283725 critical splice donor site probably null
R5468:Gbf1 UTSW 19 46284296 missense possibly damaging 0.92
R5593:Gbf1 UTSW 19 46272524 missense possibly damaging 0.91
R5595:Gbf1 UTSW 19 46284422 missense possibly damaging 0.74
R5796:Gbf1 UTSW 19 46284343 missense probably benign 0.08
R5938:Gbf1 UTSW 19 46268452 missense probably damaging 1.00
R5957:Gbf1 UTSW 19 46246221 critical splice donor site probably null
R6059:Gbf1 UTSW 19 46265248 missense probably damaging 1.00
R6120:Gbf1 UTSW 19 46279321 missense possibly damaging 0.83
R6239:Gbf1 UTSW 19 46259696 missense probably benign 0.00
R6252:Gbf1 UTSW 19 46271556 missense probably benign 0.33
R6310:Gbf1 UTSW 19 46280005 missense probably damaging 0.96
R6787:Gbf1 UTSW 19 46271772 missense probably benign
R6805:Gbf1 UTSW 19 46262507 missense probably damaging 1.00
R6855:Gbf1 UTSW 19 46279941 missense probably benign 0.00
R7313:Gbf1 UTSW 19 46280354 missense possibly damaging 0.94
R7414:Gbf1 UTSW 19 46283358 nonsense probably null
R7646:Gbf1 UTSW 19 46283672 missense probably damaging 1.00
R7650:Gbf1 UTSW 19 46272539 missense probably damaging 1.00
R7789:Gbf1 UTSW 19 46254002 missense probably damaging 1.00
R7801:Gbf1 UTSW 19 46272643 missense probably benign 0.03
R8241:Gbf1 UTSW 19 46246137 missense probably damaging 1.00
Z1177:Gbf1 UTSW 19 46259142 missense probably damaging 0.98
Predicted Primers PCR Primer
(F):5'- TCCTATCAGAGCTAGCTAGTGTCC -3'
(R):5'- CTCTGGGGTTTAAGACAAGGTG -3'

Sequencing Primer
(F):5'- GTGTCCTATATAAGAACATGCAGCTC -3'
(R):5'- GAAGTGCTAGGGCTCTGC -3'
Posted On2014-10-02