Incidental Mutation 'R6647:Ddx31'
ID526105
Institutional Source Beutler Lab
Gene Symbol Ddx31
Ensembl Gene ENSMUSG00000026806
Gene NameDEAD/H (Asp-Glu-Ala-Asp/His) box polypeptide 31
Synonyms
MMRRC Submission
Accession Numbers
Is this an essential gene? Probably essential (E-score: 0.791) question?
Stock #R6647 (G1)
Quality Score225.009
Status Validated
Chromosome2
Chromosomal Location28840406-28905571 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to T at 28875738 bp
ZygosityHeterozygous
Amino Acid Change Threonine to Serine at position 483 (T483S)
Ref Sequence ENSEMBL: ENSMUSP00000109484 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000113853]
Predicted Effect probably damaging
Transcript: ENSMUST00000113853
AA Change: T483S

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000109484
Gene: ENSMUSG00000026806
AA Change: T483S

DomainStartEndE-ValueType
DEXDc 123 332 2.28e-48 SMART
HELICc 408 487 4.02e-26 SMART
DUF4217 556 621 6.21e-22 SMART
Meta Mutation Damage Score 0.7370 question?
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.5%
  • 10x: 97.4%
  • 20x: 91.6%
Validation Efficiency 98% (53/54)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] DEAD box proteins, characterized by the conserved motif Asp-Glu-Ala-Asp (DEAD), are putative RNA helicases. They are implicated in a number of cellular processes involving alteration of RNA secondary structure such as translation initiation, nuclear and mitochondrial splicing, and ribosome and spliceosome assembly. Based on their distribution patterns, some members of this DEAD box protein family are believed to be involved in embryogenesis, spermatogenesis, and cellular growth and division. This gene encodes a member of this family. The function of this member has not been determined. Alternative splicing of this gene generates multiple transcript variants encoding different isoforms. [provided by RefSeq, Apr 2016]
Allele List at MGI
Other mutations in this stock
Total: 56 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4931408C20Rik T A 1: 26,682,578 N1174Y probably damaging Het
Agl T C 3: 116,750,411 T1416A probably damaging Het
Atp7b A G 8: 22,028,478 S103P probably damaging Het
Ces1h A C 8: 93,352,026 *563G probably null Het
Cfap157 G T 2: 32,779,074 A339E probably benign Het
Crebbp C T 16: 4,119,806 A698T possibly damaging Het
Cyp2b13 A G 7: 26,085,899 H231R possibly damaging Het
Defa25 A T 8: 21,085,185 D60V possibly damaging Het
Dnah5 G A 15: 28,403,487 A3453T probably benign Het
Dnah6 A T 6: 73,138,760 F1500I probably damaging Het
Eprs C T 1: 185,414,424 A1217V probably damaging Het
Ermp1 T C 19: 29,626,935 Y481C probably benign Het
Fam159a A G 4: 108,368,027 S113P probably benign Het
Fmn2 T A 1: 174,593,104 N635K unknown Het
Fras1 A G 5: 96,735,202 D2531G probably damaging Het
Frat1 C T 19: 41,830,825 Q220* probably null Het
Gcc2 T A 10: 58,287,281 probably null Het
Gm3285 T C 10: 77,862,613 probably benign Het
Gm9857 T C 3: 108,940,063 probably benign Het
Grin2b C A 6: 135,733,110 W1146L probably damaging Het
Hells T A 19: 38,931,504 L33I probably benign Het
Ift81 T A 5: 122,610,166 R54* probably null Het
Ints12 G A 3: 133,096,878 R41Q possibly damaging Het
Katnal2 C T 18: 76,980,037 E403K probably benign Het
Kcnk1 A G 8: 125,995,460 M1V probably null Het
Kdm5a A G 6: 120,412,461 T950A probably benign Het
Kdr G A 5: 75,952,889 A773V probably damaging Het
Lats1 G C 10: 7,697,507 M118I possibly damaging Het
Mug1 A G 6: 121,840,241 I90V probably benign Het
Nid2 A G 14: 19,802,416 D1064G probably benign Het
Nkx2-4 A T 2: 147,084,267 I225N possibly damaging Het
Nlrp4e A G 7: 23,321,315 D409G probably benign Het
Ogfod2 G C 5: 124,114,803 R292P possibly damaging Het
Olfr1163 A T 2: 88,070,709 F224L probably benign Het
Olfr781 T A 10: 129,333,164 C94* probably null Het
Olfr845 T A 9: 19,338,629 H56Q possibly damaging Het
Olfr935 T C 9: 38,994,914 I174V possibly damaging Het
Oprk1 C T 1: 5,602,284 P215S probably damaging Het
Pcdhb16 A G 18: 37,479,172 K395R possibly damaging Het
Ptprg C A 14: 11,962,714 P171T probably damaging Het
Pycard T C 7: 127,993,569 T29A probably benign Het
Rap1gap2 G A 11: 74,407,928 A452V probably benign Het
Rasgrf1 C G 9: 90,010,463 T1072S probably benign Het
Rc3h2 G A 2: 37,382,944 R707* probably null Het
Rsf1 G A 7: 97,579,910 probably benign Het
Senp7 T C 16: 56,173,255 I767T probably damaging Het
Setd7 A G 3: 51,542,762 V81A probably benign Het
Shkbp1 A G 7: 27,342,375 S685P probably benign Het
Snrnp200 A G 2: 127,226,452 E904G probably damaging Het
Spata22 T A 11: 73,354,700 probably null Het
Tas2r138 G T 6: 40,612,799 T171K possibly damaging Het
Tor1aip1 T C 1: 156,018,253 D77G possibly damaging Het
Vav3 A T 3: 109,527,416 H421L probably benign Het
Vmn1r43 A G 6: 89,869,859 L215P probably damaging Het
Vmn2r100 T A 17: 19,522,523 S386R probably benign Het
Xpa T A 4: 46,183,089 R233S probably benign Het
Other mutations in Ddx31
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01664:Ddx31 APN 2 28875835 splice site probably benign
IGL01918:Ddx31 APN 2 28874164 missense probably damaging 1.00
IGL02174:Ddx31 APN 2 28859029 missense probably damaging 1.00
IGL02560:Ddx31 APN 2 28875826 missense probably damaging 1.00
IGL02938:Ddx31 APN 2 28859023 missense possibly damaging 0.49
R0241:Ddx31 UTSW 2 28848291 missense probably damaging 1.00
R0241:Ddx31 UTSW 2 28848291 missense probably damaging 1.00
R0440:Ddx31 UTSW 2 28857132 missense probably damaging 1.00
R0701:Ddx31 UTSW 2 28858777 missense probably null 1.00
R0729:Ddx31 UTSW 2 28874174 missense probably damaging 1.00
R1227:Ddx31 UTSW 2 28857175 missense probably damaging 1.00
R1532:Ddx31 UTSW 2 28881159 missense probably benign 0.00
R1608:Ddx31 UTSW 2 28859066 missense probably damaging 0.97
R1646:Ddx31 UTSW 2 28892520 missense probably benign
R1674:Ddx31 UTSW 2 28858816 missense probably damaging 1.00
R1834:Ddx31 UTSW 2 28892453 missense probably damaging 1.00
R1884:Ddx31 UTSW 2 28858990 missense probably damaging 0.97
R4133:Ddx31 UTSW 2 28858852 missense probably damaging 1.00
R4911:Ddx31 UTSW 2 28904684 missense probably benign 0.00
R4972:Ddx31 UTSW 2 28860770 missense probably damaging 1.00
R5240:Ddx31 UTSW 2 28846030 missense probably benign 0.03
R5358:Ddx31 UTSW 2 28863770 missense probably damaging 0.98
R5450:Ddx31 UTSW 2 28886969 missense probably damaging 0.97
R5945:Ddx31 UTSW 2 28859890 missense probably damaging 1.00
R5956:Ddx31 UTSW 2 28874173 missense probably damaging 1.00
R6235:Ddx31 UTSW 2 28844842 missense probably benign 0.00
R6245:Ddx31 UTSW 2 28844982 missense probably benign 0.00
R6463:Ddx31 UTSW 2 28847513 critical splice donor site probably null
R6783:Ddx31 UTSW 2 28874176 missense probably benign 0.26
R6917:Ddx31 UTSW 2 28892409 missense probably damaging 1.00
R7135:Ddx31 UTSW 2 28848306 missense probably benign
R7819:Ddx31 UTSW 2 28892451 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- GTTTCAGTGAAGCCAACAGC -3'
(R):5'- AAGGGTTAATGGCTCTTCAGC -3'

Sequencing Primer
(F):5'- GCCAACAGCTTCAGGTTGATTAATG -3'
(R):5'- GCTCTTCAGCAGCTTACAAGG -3'
Posted On2018-06-22