Incidental Mutation 'R6688:Tpst2'
ID527855
Institutional Source Beutler Lab
Gene Symbol Tpst2
Ensembl Gene ENSMUSG00000029344
Gene Nameprotein-tyrosine sulfotransferase 2
SynonymsD5Ucla3, grm, Tango13b, grt
MMRRC Submission
Accession Numbers
Is this an essential gene? Probably essential (E-score: 0.752) question?
Stock #R6688 (G1)
Quality Score169.009
Status Validated
Chromosome5
Chromosomal Location112276691-112315361 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 112307757 bp
ZygosityHeterozygous
Amino Acid Change Asparagine to Serine at position 54 (N54S)
Ref Sequence ENSEMBL: ENSMUSP00000071399 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000031287] [ENSMUST00000071455] [ENSMUST00000151947]
Predicted Effect probably benign
Transcript: ENSMUST00000031287
AA Change: N54S

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
SMART Domains Protein: ENSMUSP00000031287
Gene: ENSMUSG00000029344
AA Change: N54S

DomainStartEndE-ValueType
low complexity region 22 43 N/A INTRINSIC
Pfam:Sulfotransfer_3 82 272 8.8e-19 PFAM
Pfam:Sulfotransfer_1 82 284 2.8e-9 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000071455
AA Change: N54S

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
SMART Domains Protein: ENSMUSP00000071399
Gene: ENSMUSG00000029344
AA Change: N54S

DomainStartEndE-ValueType
low complexity region 22 43 N/A INTRINSIC
Pfam:Sulfotransfer_3 82 276 8.4e-16 PFAM
Pfam:Sulfotransfer_1 82 284 2.8e-9 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000134071
Predicted Effect probably benign
Transcript: ENSMUST00000140262
SMART Domains Protein: ENSMUSP00000116816
Gene: ENSMUSG00000029344

DomainStartEndE-ValueType
PDB:3AP2|B 2 63 4e-36 PDB
SCOP:d1fmja_ 3 55 9e-9 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000151947
Predicted Effect probably benign
Transcript: ENSMUST00000198502
Meta Mutation Damage Score 0.0898 question?
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.7%
  • 10x: 98.5%
  • 20x: 95.8%
Validation Efficiency 100% (33/33)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene catalyzes the O-sulfation of tyrosine residues within acidic regions of proteins. The encoded protein is a type II integral membrane protein found in the Golgi body. Two transcript variants encoding the same protein have been found for this gene. [provided by RefSeq, Jul 2008]
PHENOTYPE: Spontaneous mutants show a delayed rise and a prolonged deficit of pituitary growth hormone resulting in delayed pubertal growth, hypothyroidism, and an enlarged adenohypophysis with aberrant chromophobic cells. Homozygous null mice show a modest but transient pubertal growth lag and male sterility. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 30 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Atxn1 A T 13: 45,567,671 H249Q probably damaging Het
Cd22 A C 7: 30,872,964 S362A possibly damaging Het
Cep120 G A 18: 53,724,536 P286S probably benign Het
Ces1g G A 8: 93,306,972 P441S possibly damaging Het
Ces2h A G 8: 105,017,840 I316V probably benign Het
Cntnap5c T A 17: 58,293,904 D747E possibly damaging Het
Cwf19l2 T C 9: 3,450,015 V572A probably benign Het
Cyb5rl C T 4: 107,073,905 A128V probably damaging Het
Dnttip1 T C 2: 164,765,161 Y241H probably damaging Het
Gm2381 G A 7: 42,820,586 A38V probably benign Het
Golga4 A G 9: 118,514,210 T11A possibly damaging Het
Ip6k2 C A 9: 108,806,011 T440K probably benign Het
Kif5c A G 2: 49,688,737 N126D probably benign Het
Mdn1 T A 4: 32,774,041 F5551I possibly damaging Het
Myh11 A G 16: 14,205,553 L1587P probably damaging Het
Nop53 A G 7: 15,945,854 V67A possibly damaging Het
Olfr107 G A 17: 37,405,905 R119H probably benign Het
Paxip1 T C 5: 27,744,137 T1045A probably benign Het
Pdzd3 C T 9: 44,248,230 probably null Het
Plg A T 17: 12,391,845 H215L probably damaging Het
Psmb5 C A 14: 54,616,673 R116L probably damaging Het
Rapgef2 T A 3: 79,069,128 Q1307L probably benign Het
Serpini2 T C 3: 75,259,563 E129G possibly damaging Het
Stx1b C T 7: 127,807,896 R209Q probably damaging Het
Tcf20 A G 15: 82,854,535 I905T possibly damaging Het
Tmem252 G A 19: 24,674,099 A11T probably benign Het
Usp31 T C 7: 121,678,330 S269G probably benign Het
Wasf1 T C 10: 40,926,620 probably null Het
Zfp429 A T 13: 67,396,130 V58D probably damaging Het
Zfp958 A G 8: 4,628,940 T322A possibly damaging Het
Other mutations in Tpst2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01727:Tpst2 APN 5 112309858 missense probably damaging 1.00
IGL03268:Tpst2 APN 5 112308225 missense probably damaging 1.00
blooming UTSW 5 112307757 missense probably benign
gypsum UTSW 5 112308045 missense probably damaging 1.00
hot_springs UTSW 5 112307678 missense probably benign 0.05
R1175:Tpst2 UTSW 5 112308045 missense probably damaging 1.00
R1423:Tpst2 UTSW 5 112307622 missense probably benign 0.22
R1537:Tpst2 UTSW 5 112308420 missense possibly damaging 0.48
R2013:Tpst2 UTSW 5 112308014 missense probably damaging 1.00
R4624:Tpst2 UTSW 5 112308296 missense probably damaging 1.00
R4873:Tpst2 UTSW 5 112309821 nonsense probably null
R4875:Tpst2 UTSW 5 112309821 nonsense probably null
R5272:Tpst2 UTSW 5 112307952 missense probably damaging 1.00
R6123:Tpst2 UTSW 5 112308218 missense probably damaging 1.00
R6487:Tpst2 UTSW 5 112308123 missense probably damaging 1.00
R6605:Tpst2 UTSW 5 112276734 start gained probably benign
R7240:Tpst2 UTSW 5 112307678 missense probably benign 0.05
R7625:Tpst2 UTSW 5 112308021 missense probably damaging 1.00
R7777:Tpst2 UTSW 5 112309694 missense possibly damaging 0.53
R7797:Tpst2 UTSW 5 112307916 missense probably damaging 1.00
R8306:Tpst2 UTSW 5 112307937 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- CCACAGATGTATACCAGGTGGG -3'
(R):5'- CAGAATGAAGGCCTGCATGG -3'

Sequencing Primer
(F):5'- AGGTGGGCCTGCTGACC -3'
(R):5'- AGCTTCTCACGGCCAGACTTG -3'
Posted On2018-07-23