Incidental Mutation 'R6688:Zfp429'
ID527871
Institutional Source Beutler Lab
Gene Symbol Zfp429
Ensembl Gene ENSMUSG00000078994
Gene Namezinc finger protein 429
Synonyms2810487A22Rik
MMRRC Submission
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.088) question?
Stock #R6688 (G1)
Quality Score225.009
Status Validated
Chromosome13
Chromosomal Location67387905-67399819 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to T at 67396130 bp
ZygosityHeterozygous
Amino Acid Change Valine to Aspartic acid at position 58 (V58D)
Ref Sequence ENSEMBL: ENSMUSP00000105354 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000109732] [ENSMUST00000181071] [ENSMUST00000224684] [ENSMUST00000224825]
Predicted Effect probably damaging
Transcript: ENSMUST00000109732
AA Change: V58D

PolyPhen 2 Score 0.977 (Sensitivity: 0.76; Specificity: 0.96)
SMART Domains Protein: ENSMUSP00000105354
Gene: ENSMUSG00000078994
AA Change: V58D

DomainStartEndE-ValueType
KRAB 15 75 7.16e-34 SMART
ZnF_C2H2 119 141 5.12e1 SMART
ZnF_C2H2 147 169 2.27e-4 SMART
ZnF_C2H2 175 197 1.28e-3 SMART
ZnF_C2H2 203 225 1.56e-2 SMART
ZnF_C2H2 259 281 4.62e1 SMART
ZnF_C2H2 287 309 5.14e-3 SMART
ZnF_C2H2 315 337 6.78e-3 SMART
ZnF_C2H2 343 365 3.11e-2 SMART
ZnF_C2H2 371 393 1.25e-1 SMART
ZnF_C2H2 399 421 6.32e-3 SMART
ZnF_C2H2 427 449 1.47e-3 SMART
ZnF_C2H2 455 477 5.42e-2 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000181071
AA Change: V58D

PolyPhen 2 Score 0.063 (Sensitivity: 0.94; Specificity: 0.84)
SMART Domains Protein: ENSMUSP00000137755
Gene: ENSMUSG00000078994
AA Change: V58D

DomainStartEndE-ValueType
KRAB 15 75 7.16e-34 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000224684
AA Change: V58D

PolyPhen 2 Score 0.022 (Sensitivity: 0.95; Specificity: 0.81)
Predicted Effect probably benign
Transcript: ENSMUST00000224825
AA Change: V45D

PolyPhen 2 Score 0.026 (Sensitivity: 0.95; Specificity: 0.81)
Predicted Effect noncoding transcript
Transcript: ENSMUST00000225810
Meta Mutation Damage Score 0.6467 question?
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.7%
  • 10x: 98.5%
  • 20x: 95.8%
Validation Efficiency 100% (33/33)
Allele List at MGI
Other mutations in this stock
Total: 30 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Atxn1 A T 13: 45,567,671 H249Q probably damaging Het
Cd22 A C 7: 30,872,964 S362A possibly damaging Het
Cep120 G A 18: 53,724,536 P286S probably benign Het
Ces1g G A 8: 93,306,972 P441S possibly damaging Het
Ces2h A G 8: 105,017,840 I316V probably benign Het
Cntnap5c T A 17: 58,293,904 D747E possibly damaging Het
Cwf19l2 T C 9: 3,450,015 V572A probably benign Het
Cyb5rl C T 4: 107,073,905 A128V probably damaging Het
Dnttip1 T C 2: 164,765,161 Y241H probably damaging Het
Gm2381 G A 7: 42,820,586 A38V probably benign Het
Golga4 A G 9: 118,514,210 T11A possibly damaging Het
Ip6k2 C A 9: 108,806,011 T440K probably benign Het
Kif5c A G 2: 49,688,737 N126D probably benign Het
Mdn1 T A 4: 32,774,041 F5551I possibly damaging Het
Myh11 A G 16: 14,205,553 L1587P probably damaging Het
Nop53 A G 7: 15,945,854 V67A possibly damaging Het
Olfr107 G A 17: 37,405,905 R119H probably benign Het
Paxip1 T C 5: 27,744,137 T1045A probably benign Het
Pdzd3 C T 9: 44,248,230 probably null Het
Plg A T 17: 12,391,845 H215L probably damaging Het
Psmb5 C A 14: 54,616,673 R116L probably damaging Het
Rapgef2 T A 3: 79,069,128 Q1307L probably benign Het
Serpini2 T C 3: 75,259,563 E129G possibly damaging Het
Stx1b C T 7: 127,807,896 R209Q probably damaging Het
Tcf20 A G 15: 82,854,535 I905T possibly damaging Het
Tmem252 G A 19: 24,674,099 A11T probably benign Het
Tpst2 A G 5: 112,307,757 N54S probably benign Het
Usp31 T C 7: 121,678,330 S269G probably benign Het
Wasf1 T C 10: 40,926,620 probably null Het
Zfp958 A G 8: 4,628,940 T322A possibly damaging Het
Other mutations in Zfp429
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01160:Zfp429 APN 13 67391013 missense probably damaging 0.96
IGL01913:Zfp429 APN 13 67396674 missense probably damaging 1.00
IGL02343:Zfp429 APN 13 67390725 missense probably damaging 0.98
IGL02679:Zfp429 APN 13 67399736 intron probably benign
IGL03396:Zfp429 APN 13 67396040 splice site probably benign
FR4342:Zfp429 UTSW 13 67396650 missense probably benign 0.02
R0012:Zfp429 UTSW 13 67390677 missense probably benign 0.01
R1232:Zfp429 UTSW 13 67390632 missense possibly damaging 0.47
R1330:Zfp429 UTSW 13 67396143 splice site probably null
R1653:Zfp429 UTSW 13 67389924 missense possibly damaging 0.87
R1761:Zfp429 UTSW 13 67396076 missense probably benign 0.28
R1813:Zfp429 UTSW 13 67390386 missense possibly damaging 0.55
R2356:Zfp429 UTSW 13 67390627 missense probably benign
R4280:Zfp429 UTSW 13 67390795 missense probably damaging 1.00
R4283:Zfp429 UTSW 13 67390795 missense probably damaging 1.00
R4464:Zfp429 UTSW 13 67390498 missense probably benign 0.13
R4789:Zfp429 UTSW 13 67390404 missense probably benign 0.06
R5187:Zfp429 UTSW 13 67390840 missense probably damaging 0.99
R5250:Zfp429 UTSW 13 67390519 missense probably benign 0.00
R6772:Zfp429 UTSW 13 67390198 missense probably damaging 1.00
R6989:Zfp429 UTSW 13 67389961 missense probably benign 0.00
R7041:Zfp429 UTSW 13 67390711 missense probably damaging 1.00
R7101:Zfp429 UTSW 13 67390812 missense possibly damaging 0.88
R7593:Zfp429 UTSW 13 67390291 missense probably damaging 1.00
R7792:Zfp429 UTSW 13 67390439 nonsense probably null
Predicted Primers PCR Primer
(F):5'- ATGTCTGAGAGATGTTTAAGAGAGACC -3'
(R):5'- ATCAGGCGTGGACCACATTTG -3'

Sequencing Primer
(F):5'- CACTTTCCTACATACCTGGG -3'
(R):5'- AGGCGTGGACCACATTTGTTAATG -3'
Posted On2018-07-23