Incidental Mutation 'R6688:Zfp958'
ID527862
Institutional Source Beutler Lab
Gene Symbol Zfp958
Ensembl Gene ENSMUSG00000058748
Gene Namezinc finger protein 958
SynonymsBC003267
MMRRC Submission
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.084) question?
Stock #R6688 (G1)
Quality Score225.009
Status Validated
Chromosome8
Chromosomal Location4613167-4630231 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 4628940 bp
ZygosityHeterozygous
Amino Acid Change Threonine to Alanine at position 322 (T322A)
Ref Sequence ENSEMBL: ENSMUSP00000143842 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000073201] [ENSMUST00000202692]
Predicted Effect probably benign
Transcript: ENSMUST00000073201
AA Change: T321A

PolyPhen 2 Score 0.444 (Sensitivity: 0.89; Specificity: 0.90)
SMART Domains Protein: ENSMUSP00000072937
Gene: ENSMUSG00000058748
AA Change: T321A

DomainStartEndE-ValueType
KRAB 3 65 1.96e-17 SMART
ZnF_C2H2 102 124 2.67e-1 SMART
ZnF_C2H2 130 152 8.47e-4 SMART
ZnF_C2H2 158 180 5.5e-3 SMART
ZnF_C2H2 186 208 1.38e-3 SMART
ZnF_C2H2 214 236 9.96e-1 SMART
ZnF_C2H2 242 264 2.15e-5 SMART
ZnF_C2H2 270 292 3.16e-3 SMART
ZnF_C2H2 298 320 1.69e-3 SMART
ZnF_C2H2 326 348 5.14e-3 SMART
ZnF_C2H2 354 376 2.91e-2 SMART
ZnF_C2H2 382 404 2.27e-4 SMART
ZnF_C2H2 410 432 4.79e-3 SMART
ZnF_C2H2 438 460 6.88e-4 SMART
Predicted Effect possibly damaging
Transcript: ENSMUST00000202692
AA Change: T322A

PolyPhen 2 Score 0.909 (Sensitivity: 0.81; Specificity: 0.94)
SMART Domains Protein: ENSMUSP00000143842
Gene: ENSMUSG00000058748
AA Change: T322A

DomainStartEndE-ValueType
KRAB 4 66 1.96e-17 SMART
ZnF_C2H2 103 125 2.67e-1 SMART
ZnF_C2H2 131 153 8.47e-4 SMART
ZnF_C2H2 159 181 5.5e-3 SMART
ZnF_C2H2 187 209 1.38e-3 SMART
ZnF_C2H2 215 237 9.96e-1 SMART
ZnF_C2H2 243 265 2.15e-5 SMART
ZnF_C2H2 271 293 3.16e-3 SMART
ZnF_C2H2 299 321 1.69e-3 SMART
ZnF_C2H2 327 349 5.14e-3 SMART
ZnF_C2H2 355 377 2.91e-2 SMART
ZnF_C2H2 383 405 2.27e-4 SMART
ZnF_C2H2 411 433 4.79e-3 SMART
ZnF_C2H2 439 461 6.88e-4 SMART
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.7%
  • 10x: 98.5%
  • 20x: 95.8%
Validation Efficiency 100% (33/33)
Allele List at MGI
Other mutations in this stock
Total: 30 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Atxn1 A T 13: 45,567,671 H249Q probably damaging Het
Cd22 A C 7: 30,872,964 S362A possibly damaging Het
Cep120 G A 18: 53,724,536 P286S probably benign Het
Ces1g G A 8: 93,306,972 P441S possibly damaging Het
Ces2h A G 8: 105,017,840 I316V probably benign Het
Cntnap5c T A 17: 58,293,904 D747E possibly damaging Het
Cwf19l2 T C 9: 3,450,015 V572A probably benign Het
Cyb5rl C T 4: 107,073,905 A128V probably damaging Het
Dnttip1 T C 2: 164,765,161 Y241H probably damaging Het
Gm2381 G A 7: 42,820,586 A38V probably benign Het
Golga4 A G 9: 118,514,210 T11A possibly damaging Het
Ip6k2 C A 9: 108,806,011 T440K probably benign Het
Kif5c A G 2: 49,688,737 N126D probably benign Het
Mdn1 T A 4: 32,774,041 F5551I possibly damaging Het
Myh11 A G 16: 14,205,553 L1587P probably damaging Het
Nop53 A G 7: 15,945,854 V67A possibly damaging Het
Olfr107 G A 17: 37,405,905 R119H probably benign Het
Paxip1 T C 5: 27,744,137 T1045A probably benign Het
Pdzd3 C T 9: 44,248,230 probably null Het
Plg A T 17: 12,391,845 H215L probably damaging Het
Psmb5 C A 14: 54,616,673 R116L probably damaging Het
Rapgef2 T A 3: 79,069,128 Q1307L probably benign Het
Serpini2 T C 3: 75,259,563 E129G possibly damaging Het
Stx1b C T 7: 127,807,896 R209Q probably damaging Het
Tcf20 A G 15: 82,854,535 I905T possibly damaging Het
Tmem252 G A 19: 24,674,099 A11T probably benign Het
Tpst2 A G 5: 112,307,757 N54S probably benign Het
Usp31 T C 7: 121,678,330 S269G probably benign Het
Wasf1 T C 10: 40,926,620 probably null Het
Zfp429 A T 13: 67,396,130 V58D probably damaging Het
Other mutations in Zfp958
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01950:Zfp958 APN 8 4628917 missense probably damaging 1.00
IGL02185:Zfp958 APN 8 4628990 nonsense probably null
IGL02716:Zfp958 APN 8 4625967 critical splice donor site probably null
R1118:Zfp958 UTSW 8 4626169 missense possibly damaging 0.50
R1119:Zfp958 UTSW 8 4626169 missense possibly damaging 0.50
R1478:Zfp958 UTSW 8 4629190 missense probably damaging 1.00
R1816:Zfp958 UTSW 8 4629147 missense possibly damaging 0.89
R1837:Zfp958 UTSW 8 4628590 missense probably damaging 1.00
R1838:Zfp958 UTSW 8 4628590 missense probably damaging 1.00
R3763:Zfp958 UTSW 8 4626226 critical splice donor site probably null
R5257:Zfp958 UTSW 8 4628456 missense probably benign 0.28
R5258:Zfp958 UTSW 8 4628456 missense probably benign 0.28
R5304:Zfp958 UTSW 8 4626196 missense possibly damaging 0.73
R5512:Zfp958 UTSW 8 4625838 critical splice acceptor site probably null
R5907:Zfp958 UTSW 8 4629072 missense probably benign 0.01
R6604:Zfp958 UTSW 8 4628245 missense probably damaging 1.00
R6727:Zfp958 UTSW 8 4628247 missense probably benign 0.08
R6981:Zfp958 UTSW 8 4626170 missense probably benign 0.00
R7010:Zfp958 UTSW 8 4628377 missense probably benign 0.13
R7140:Zfp958 UTSW 8 4628481 missense probably benign 0.05
R8096:Zfp958 UTSW 8 4613273 start gained probably benign
Predicted Primers PCR Primer
(F):5'- TTTGCATGTCTCAGCTATCTTCGA -3'
(R):5'- ATCATATGGAAAGGCTTTACCACA -3'

Sequencing Primer
(F):5'- CAGCTATCTTCGAGTGCATGGAAG -3'
(R):5'- GCCACATTGATTACATCTGAAGGG -3'
Posted On2018-07-23