Incidental Mutation 'R6727:Olfr365'
ID529892
Institutional Source Beutler Lab
Gene Symbol Olfr365
Ensembl Gene ENSMUSG00000059429
Gene Nameolfactory receptor 365
SynonymsGA_x6K02T2NLDC-33885305-33886243, MOR138-1
MMRRC Submission
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.173) question?
Stock #R6727 (G1)
Quality Score225.009
Status Validated
Chromosome2
Chromosomal Location37188198-37206019 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to A at 37202106 bp
ZygosityHeterozygous
Amino Acid Change Asparagine to Lysine at position 288 (N288K)
Ref Sequence ENSEMBL: ENSMUSP00000151617 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000074168] [ENSMUST00000213969] [ENSMUST00000218602]
Predicted Effect probably damaging
Transcript: ENSMUST00000074168
AA Change: N288K

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000073801
Gene: ENSMUSG00000059429
AA Change: N288K

DomainStartEndE-ValueType
low complexity region 5 12 N/A INTRINSIC
Pfam:7tm_4 33 309 4.7e-58 PFAM
Pfam:7tm_1 43 292 2.2e-24 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000120111
Predicted Effect probably damaging
Transcript: ENSMUST00000213969
AA Change: N288K

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
Predicted Effect probably damaging
Transcript: ENSMUST00000218602
AA Change: N288K

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.7%
  • 10x: 98.5%
  • 20x: 96.1%
Validation Efficiency 98% (44/45)
MGI Phenotype FUNCTION: Olfactory receptors interact with odorant molecules in the nose, to initiate a neuronal response that triggers the perception of a smell. The olfactory receptor proteins are members of a large family of G-protein-coupled receptors (GPCR) arising from single coding-exon genes. Olfactory receptors share a 7-transmembrane domain structure with many neurotransmitter and hormone receptors and are responsible for the recognition and G protein-mediated transduction of odorant signals. The olfactory receptor gene family is the largest in the genome. The nomenclature assigned to the olfactory receptor genes and proteins for this organism is independent of other organisms. [provided by RefSeq, Jul 2008]
Allele List at MGI
Other mutations in this stock
Total: 46 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2010109A12Rik A G 5: 93,206,575 probably benign Het
4930563M21Rik C T 9: 55,989,476 V283I possibly damaging Het
4933408B17Rik T A 18: 34,580,841 M244L probably benign Het
Acot11 C T 4: 106,760,130 G240R probably damaging Het
Allc T A 12: 28,557,389 H288L probably damaging Het
Atg16l1 T C 1: 87,774,854 I279T possibly damaging Het
Atp6v1b1 A G 6: 83,751,875 probably benign Het
Barhl1 G A 2: 28,915,483 P66L probably benign Het
Cfap58 A T 19: 47,955,417 D352V probably benign Het
Cyp3a44 T A 5: 145,794,971 K122* probably null Het
Dnaic1 G T 4: 41,625,308 R424L probably benign Het
Dync1li2 G T 8: 104,440,535 H79Q probably damaging Het
Fem1b A G 9: 62,796,733 V415A possibly damaging Het
Fgb C T 3: 83,046,787 S48N possibly damaging Het
Gm5624 T C 14: 44,561,875 D31G possibly damaging Het
Gm8909 A T 17: 36,165,730 V284E probably damaging Het
Gzmn T A 14: 56,165,975 I226F probably damaging Het
Il31ra T C 13: 112,547,368 S184G probably damaging Het
Insrr C T 3: 87,813,566 R1044C probably damaging Het
Kcnj15 A G 16: 95,296,334 S272G probably damaging Het
Kcnk16 C T 14: 20,262,929 A106T probably benign Het
Kmt2b A G 7: 30,584,559 V876A probably damaging Het
Large2 G T 2: 92,370,870 probably benign Het
Maml2 A T 9: 13,621,551 probably benign Het
Me1 A G 9: 86,582,798 L533P possibly damaging Het
Muc16 A G 9: 18,566,690 probably null Het
Nova2 C A 7: 18,958,494 T516K probably damaging Het
Olfr657 T C 7: 104,635,887 I71T probably damaging Het
Otogl G A 10: 107,777,117 silent Het
Ppp2r1a T A 17: 20,955,825 V103E probably benign Het
Prl3d3 G A 13: 27,157,164 probably null Het
Rhbdf1 G T 11: 32,214,042 A288E possibly damaging Het
Rnf213 T C 11: 119,430,321 S1202P possibly damaging Het
Slc25a17 A G 15: 81,337,953 V106A probably benign Het
Slc4a4 T G 5: 89,170,765 S640A probably benign Het
Smc4 T A 3: 69,016,772 Y298N probably damaging Het
Tek G T 4: 94,853,495 G830* probably null Het
Tgfb1 A T 7: 25,689,162 probably benign Het
Themis T C 10: 28,781,907 I157T probably damaging Het
Trmt12 A G 15: 58,872,665 probably benign Het
Trrap T C 5: 144,856,950 W3654R probably damaging Het
Tspan3 C T 9: 56,147,440 G108S probably damaging Het
Ugt1a10 T A 1: 88,056,257 probably null Het
Vps13b A G 15: 35,770,683 K2091E probably benign Het
Wdr62 A T 7: 30,271,620 V184D probably damaging Het
Zfp958 C A 8: 4,628,247 Q90K probably benign Het
Other mutations in Olfr365
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00339:Olfr365 APN 2 37201597 missense probably damaging 1.00
IGL00943:Olfr365 APN 2 37202171 missense probably benign 0.08
IGL01100:Olfr365 APN 2 37201640 missense possibly damaging 0.58
IGL01696:Olfr365 APN 2 37201511 missense probably benign 0.00
IGL02119:Olfr365 APN 2 37201269 missense possibly damaging 0.73
IGL02807:Olfr365 APN 2 37201574 missense probably damaging 1.00
IGL03030:Olfr365 APN 2 37201871 missense probably benign 0.00
R0388:Olfr365 UTSW 2 37202184 unclassified probably null
R0788:Olfr365 UTSW 2 37202023 missense possibly damaging 0.90
R1126:Olfr365 UTSW 2 37202101 missense probably benign
R1753:Olfr365 UTSW 2 37201427 missense probably damaging 1.00
R1822:Olfr365 UTSW 2 37201980 missense probably damaging 1.00
R1837:Olfr365 UTSW 2 37202102 missense probably benign 0.23
R3711:Olfr365 UTSW 2 37201273 missense probably benign
R4077:Olfr365 UTSW 2 37202012 missense possibly damaging 0.79
R4078:Olfr365 UTSW 2 37202012 missense possibly damaging 0.79
R4375:Olfr365 UTSW 2 37201562 missense probably benign 0.33
R4607:Olfr365 UTSW 2 37202082 nonsense probably null
R4608:Olfr365 UTSW 2 37202082 nonsense probably null
R4889:Olfr365 UTSW 2 37202045 missense probably damaging 1.00
R5398:Olfr365 UTSW 2 37201318 missense probably benign 0.33
R5560:Olfr365 UTSW 2 37201930 missense probably benign 0.01
R5670:Olfr365 UTSW 2 37201994 missense probably benign 0.19
R6108:Olfr365 UTSW 2 37201766 missense possibly damaging 0.68
R6860:Olfr365 UTSW 2 37202177 missense possibly damaging 0.96
R7079:Olfr365 UTSW 2 37202173 missense probably benign 0.00
R7113:Olfr365 UTSW 2 37201556 missense possibly damaging 0.74
R7278:Olfr365 UTSW 2 37202080 missense probably damaging 1.00
R7731:Olfr365 UTSW 2 37201549 missense probably benign 0.07
R8096:Olfr365 UTSW 2 37202066 missense probably damaging 0.99
Predicted Primers PCR Primer
(F):5'- ATTCCCTCTGCAGCTGGAAAATG -3'
(R):5'- ATGTGTGATGGTACCTGCAGAG -3'

Sequencing Primer
(F):5'- GCTGGAAAATGGAAAGCCTTCTCTAC -3'
(R):5'- AGGAGGACATTGTTACATGTCCC -3'
Posted On2018-08-01