Incidental Mutation 'R6727:Smc4'
ID529894
Institutional Source Beutler Lab
Gene Symbol Smc4
Ensembl Gene ENSMUSG00000034349
Gene Namestructural maintenance of chromosomes 4
Synonyms2500002A22Rik, Smc4l1
MMRRC Submission
Accession Numbers
Is this an essential gene? Probably essential (E-score: 0.966) question?
Stock #R6727 (G1)
Quality Score225.009
Status Validated
Chromosome3
Chromosomal Location69004738-69034623 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to A at 69016772 bp
ZygosityHeterozygous
Amino Acid Change Tyrosine to Asparagine at position 298 (Y298N)
Ref Sequence ENSEMBL: ENSMUSP00000103433 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000042901] [ENSMUST00000107803] [ENSMUST00000136502] [ENSMUST00000148385] [ENSMUST00000195525]
Predicted Effect probably damaging
Transcript: ENSMUST00000042901
AA Change: Y323N

PolyPhen 2 Score 0.984 (Sensitivity: 0.74; Specificity: 0.96)
SMART Domains Protein: ENSMUSP00000047872
Gene: ENSMUSG00000034349
AA Change: Y323N

DomainStartEndE-ValueType
PDB:1W1W|D 89 238 1e-17 PDB
Blast:AAA 104 238 3e-6 BLAST
low complexity region 408 427 N/A INTRINSIC
low complexity region 447 460 N/A INTRINSIC
low complexity region 473 482 N/A INTRINSIC
low complexity region 545 567 N/A INTRINSIC
SMC_hinge 611 726 1.12e-31 SMART
low complexity region 870 881 N/A INTRINSIC
low complexity region 942 953 N/A INTRINSIC
Blast:AAA 1102 1276 5e-26 BLAST
PDB:3KTA|D 1125 1276 3e-30 PDB
SCOP:d1e69a_ 1188 1263 3e-5 SMART
Predicted Effect probably damaging
Transcript: ENSMUST00000107803
AA Change: Y298N

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000103433
Gene: ENSMUSG00000034349
AA Change: Y298N

DomainStartEndE-ValueType
Pfam:AAA_23 59 329 1.3e-12 PFAM
Pfam:AAA_21 81 199 5.2e-7 PFAM
coiled coil region 369 482 N/A INTRINSIC
coiled coil region 511 563 N/A INTRINSIC
SMC_hinge 586 701 8.6e-36 SMART
Pfam:SMC_N 738 1247 1.1e-35 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000124983
Predicted Effect noncoding transcript
Transcript: ENSMUST00000128134
Predicted Effect possibly damaging
Transcript: ENSMUST00000136502
AA Change: Y323N

PolyPhen 2 Score 0.781 (Sensitivity: 0.85; Specificity: 0.93)
SMART Domains Protein: ENSMUSP00000115033
Gene: ENSMUSG00000034349
AA Change: Y323N

DomainStartEndE-ValueType
Pfam:SMC_N 81 303 1.2e-42 PFAM
Pfam:AAA_23 84 336 2.6e-16 PFAM
Pfam:AAA_21 106 227 1e-9 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000148385
Predicted Effect noncoding transcript
Transcript: ENSMUST00000156354
Predicted Effect probably benign
Transcript: ENSMUST00000195525
Meta Mutation Damage Score 0.1058 question?
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.7%
  • 10x: 98.5%
  • 20x: 96.1%
Validation Efficiency 98% (44/45)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene belongs to the 'structural maintenance of chromosomes' (SMC) gene family. Members of this gene family play a role in two changes in chromosome structure during mitotic segregation of chromosomes- chromosome condensation and sister chromatid cohesion. The protein encoded by this gene is likely a subunit of the 13S condensin complex, which is involved in chromosome condensation. A pseudogene related to this gene is located on chromosome 2. [provided by RefSeq, Jun 2016]
Allele List at MGI
Other mutations in this stock
Total: 46 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2010109A12Rik A G 5: 93,206,575 probably benign Het
4930563M21Rik C T 9: 55,989,476 V283I possibly damaging Het
4933408B17Rik T A 18: 34,580,841 M244L probably benign Het
Acot11 C T 4: 106,760,130 G240R probably damaging Het
Allc T A 12: 28,557,389 H288L probably damaging Het
Atg16l1 T C 1: 87,774,854 I279T possibly damaging Het
Atp6v1b1 A G 6: 83,751,875 probably benign Het
Barhl1 G A 2: 28,915,483 P66L probably benign Het
Cfap58 A T 19: 47,955,417 D352V probably benign Het
Cyp3a44 T A 5: 145,794,971 K122* probably null Het
Dnaic1 G T 4: 41,625,308 R424L probably benign Het
Dync1li2 G T 8: 104,440,535 H79Q probably damaging Het
Fem1b A G 9: 62,796,733 V415A possibly damaging Het
Fgb C T 3: 83,046,787 S48N possibly damaging Het
Gm5624 T C 14: 44,561,875 D31G possibly damaging Het
Gm8909 A T 17: 36,165,730 V284E probably damaging Het
Gzmn T A 14: 56,165,975 I226F probably damaging Het
Il31ra T C 13: 112,547,368 S184G probably damaging Het
Insrr C T 3: 87,813,566 R1044C probably damaging Het
Kcnj15 A G 16: 95,296,334 S272G probably damaging Het
Kcnk16 C T 14: 20,262,929 A106T probably benign Het
Kmt2b A G 7: 30,584,559 V876A probably damaging Het
Large2 G T 2: 92,370,870 probably benign Het
Maml2 A T 9: 13,621,551 probably benign Het
Me1 A G 9: 86,582,798 L533P possibly damaging Het
Muc16 A G 9: 18,566,690 probably null Het
Nova2 C A 7: 18,958,494 T516K probably damaging Het
Olfr365 T A 2: 37,202,106 N288K probably damaging Het
Olfr657 T C 7: 104,635,887 I71T probably damaging Het
Otogl G A 10: 107,777,117 silent Het
Ppp2r1a T A 17: 20,955,825 V103E probably benign Het
Prl3d3 G A 13: 27,157,164 probably null Het
Rhbdf1 G T 11: 32,214,042 A288E possibly damaging Het
Rnf213 T C 11: 119,430,321 S1202P possibly damaging Het
Slc25a17 A G 15: 81,337,953 V106A probably benign Het
Slc4a4 T G 5: 89,170,765 S640A probably benign Het
Tek G T 4: 94,853,495 G830* probably null Het
Tgfb1 A T 7: 25,689,162 probably benign Het
Themis T C 10: 28,781,907 I157T probably damaging Het
Trmt12 A G 15: 58,872,665 probably benign Het
Trrap T C 5: 144,856,950 W3654R probably damaging Het
Tspan3 C T 9: 56,147,440 G108S probably damaging Het
Ugt1a10 T A 1: 88,056,257 probably null Het
Vps13b A G 15: 35,770,683 K2091E probably benign Het
Wdr62 A T 7: 30,271,620 V184D probably damaging Het
Zfp958 C A 8: 4,628,247 Q90K probably benign Het
Other mutations in Smc4
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00401:Smc4 APN 3 69030379 missense probably damaging 0.98
IGL00542:Smc4 APN 3 69028438 splice site probably benign
IGL01104:Smc4 APN 3 69027584 missense possibly damaging 0.95
IGL01380:Smc4 APN 3 69025828 missense probably damaging 1.00
IGL01397:Smc4 APN 3 69031544 missense probably benign
IGL02441:Smc4 APN 3 69006211 missense probably damaging 1.00
IGL02629:Smc4 APN 3 69025873 missense probably damaging 0.96
IGL03220:Smc4 APN 3 69009542 missense possibly damaging 0.67
pyrrhic UTSW 3 69027502 missense probably damaging 1.00
R0452:Smc4 UTSW 3 69008028 nonsense probably null
R0523:Smc4 UTSW 3 69025888 missense probably damaging 1.00
R0568:Smc4 UTSW 3 69022461 critical splice donor site probably null
R0571:Smc4 UTSW 3 69024289 missense probably damaging 1.00
R0602:Smc4 UTSW 3 69009538 missense probably damaging 1.00
R0925:Smc4 UTSW 3 69006215 critical splice donor site probably benign
R0963:Smc4 UTSW 3 69025926 missense probably damaging 1.00
R1540:Smc4 UTSW 3 69016772 missense probably damaging 1.00
R1755:Smc4 UTSW 3 69034108 missense probably damaging 1.00
R1920:Smc4 UTSW 3 69033068 missense probably damaging 1.00
R4226:Smc4 UTSW 3 69031467 missense probably benign 0.01
R4510:Smc4 UTSW 3 69016647 splice site probably null
R4511:Smc4 UTSW 3 69016647 splice site probably null
R4899:Smc4 UTSW 3 69031811 missense probably damaging 0.97
R4967:Smc4 UTSW 3 69018239 intron probably benign
R5096:Smc4 UTSW 3 69021279 missense probably damaging 1.00
R5101:Smc4 UTSW 3 69028512 missense probably benign 0.00
R5588:Smc4 UTSW 3 69025857 missense probably benign
R5631:Smc4 UTSW 3 69030312 missense probably benign 0.16
R5633:Smc4 UTSW 3 69008110 missense probably damaging 1.00
R6229:Smc4 UTSW 3 69030247 nonsense probably null
R6300:Smc4 UTSW 3 69027891 missense probably benign 0.00
R6554:Smc4 UTSW 3 69029515 missense probably benign 0.00
R6596:Smc4 UTSW 3 69025893 missense probably damaging 1.00
R6603:Smc4 UTSW 3 69022461 critical splice donor site probably null
R6682:Smc4 UTSW 3 69007241 missense probably damaging 0.98
R6955:Smc4 UTSW 3 69024309 missense possibly damaging 0.95
R7037:Smc4 UTSW 3 69018195 missense possibly damaging 0.67
R7051:Smc4 UTSW 3 69027502 missense probably damaging 1.00
R7454:Smc4 UTSW 3 69018124 missense probably benign
R7630:Smc4 UTSW 3 69018067 critical splice acceptor site probably benign
R7632:Smc4 UTSW 3 69018067 critical splice acceptor site probably benign
R7633:Smc4 UTSW 3 69018067 critical splice acceptor site probably benign
R7773:Smc4 UTSW 3 69016163 missense probably damaging 1.00
R7857:Smc4 UTSW 3 69033219 missense possibly damaging 0.61
R7940:Smc4 UTSW 3 69033219 missense possibly damaging 0.61
R8008:Smc4 UTSW 3 69007312 missense probably damaging 0.99
X0063:Smc4 UTSW 3 69018103 missense possibly damaging 0.47
Predicted Primers PCR Primer
(F):5'- TAGCCTTTGCGTGACATGC -3'
(R):5'- GTTACTGCATGTAATATGTGCCC -3'

Sequencing Primer
(F):5'- CCTTTGCGTGACATGCTTTTATTTAG -3'
(R):5'- ATGTAATATGTGCCCCCACTCAC -3'
Posted On2018-08-01