Incidental Mutation 'R6727:Large2'
ID529893
Institutional Source Beutler Lab
Gene Symbol Large2
Ensembl Gene ENSMUSG00000040434
Gene NameLARGE xylosyl- and glucuronyltransferase 2
Synonyms5730485C17Rik, Gyltl1b
MMRRC Submission
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R6727 (G1)
Quality Score225.009
Status Validated
Chromosome2
Chromosomal Location92365046-92374869 bp(-) (GRCm38)
Type of Mutationutr 5 prime
DNA Base Change (assembly) G to T at 92370870 bp
ZygosityHeterozygous
Amino Acid Change
Ref Sequence ENSEMBL: ENSMUSP00000135024 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000028650] [ENSMUST00000068586] [ENSMUST00000090582] [ENSMUST00000111284] [ENSMUST00000148352] [ENSMUST00000176289] [ENSMUST00000176339] [ENSMUST00000176774] [ENSMUST00000176810]
Predicted Effect probably benign
Transcript: ENSMUST00000028650
SMART Domains Protein: ENSMUSP00000028650
Gene: ENSMUSG00000027222

DomainStartEndE-ValueType
Pfam:Pex16 9 329 1.3e-91 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000068586
SMART Domains Protein: ENSMUSP00000064128
Gene: ENSMUSG00000040434

DomainStartEndE-ValueType
signal peptide 1 24 N/A INTRINSIC
low complexity region 52 63 N/A INTRINSIC
Pfam:Glyco_transf_8 70 316 4.6e-22 PFAM
low complexity region 392 401 N/A INTRINSIC
Pfam:Glyco_transf_49 402 469 2.2e-11 PFAM
Pfam:Glyco_transf_49 466 673 1e-42 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000090582
SMART Domains Protein: ENSMUSP00000088070
Gene: ENSMUSG00000040434

DomainStartEndE-ValueType
signal peptide 1 24 N/A INTRINSIC
low complexity region 52 63 N/A INTRINSIC
Pfam:Glyco_transf_8 70 218 7.2e-9 PFAM
Pfam:Glyco_transf_8 188 281 2.3e-8 PFAM
low complexity region 357 366 N/A INTRINSIC
Pfam:Glyco_transf_49 367 434 2.1e-11 PFAM
Pfam:Glyco_transf_49 431 638 9.3e-43 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000111284
SMART Domains Protein: ENSMUSP00000106915
Gene: ENSMUSG00000040434

DomainStartEndE-ValueType
signal peptide 1 24 N/A INTRINSIC
low complexity region 77 88 N/A INTRINSIC
Pfam:Glyco_transf_8 97 341 8.9e-22 PFAM
low complexity region 417 426 N/A INTRINSIC
Pfam:Glyco_transf_49 427 494 6.5e-11 PFAM
Pfam:Glyco_transf_49 491 698 3.1e-42 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000124428
Predicted Effect noncoding transcript
Transcript: ENSMUST00000130283
Predicted Effect noncoding transcript
Transcript: ENSMUST00000146311
Predicted Effect probably benign
Transcript: ENSMUST00000148352
SMART Domains Protein: ENSMUSP00000135451
Gene: ENSMUSG00000040434

DomainStartEndE-ValueType
signal peptide 1 24 N/A INTRINSIC
low complexity region 52 63 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000148386
Predicted Effect noncoding transcript
Transcript: ENSMUST00000154669
Predicted Effect noncoding transcript
Transcript: ENSMUST00000155891
Predicted Effect noncoding transcript
Transcript: ENSMUST00000175740
Predicted Effect noncoding transcript
Transcript: ENSMUST00000175851
Predicted Effect probably benign
Transcript: ENSMUST00000176289
SMART Domains Protein: ENSMUSP00000135118
Gene: ENSMUSG00000040434

DomainStartEndE-ValueType
signal peptide 1 24 N/A INTRINSIC
low complexity region 52 63 N/A INTRINSIC
Predicted Effect unknown
Transcript: ENSMUST00000176339
AA Change: P12Q
SMART Domains Protein: ENSMUSP00000135619
Gene: ENSMUSG00000040434
AA Change: P12Q

DomainStartEndE-ValueType
transmembrane domain 31 50 N/A INTRINSIC
low complexity region 74 85 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000176402
Predicted Effect noncoding transcript
Transcript: ENSMUST00000176646
Predicted Effect probably benign
Transcript: ENSMUST00000176774
SMART Domains Protein: ENSMUSP00000135400
Gene: ENSMUSG00000040434

DomainStartEndE-ValueType
signal peptide 1 24 N/A INTRINSIC
low complexity region 52 63 N/A INTRINSIC
Pfam:Glyco_transf_8 71 317 3.9e-22 PFAM
low complexity region 393 402 N/A INTRINSIC
Pfam:Glyco_transf_49 403 470 1.6e-11 PFAM
Pfam:Glyco_transf_49 467 674 7.4e-43 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000176810
SMART Domains Protein: ENSMUSP00000135024
Gene: ENSMUSG00000040434

DomainStartEndE-ValueType
signal peptide 1 24 N/A INTRINSIC
low complexity region 77 88 N/A INTRINSIC
Pfam:Glyco_transf_8 101 342 4.2e-20 PFAM
low complexity region 417 426 N/A INTRINSIC
Pfam:Glyco_transf_49 427 493 1.3e-13 PFAM
Pfam:Glyco_transf_49 489 698 2.8e-46 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000176820
Predicted Effect noncoding transcript
Transcript: ENSMUST00000177273
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.7%
  • 10x: 98.5%
  • 20x: 96.1%
Validation Efficiency 98% (44/45)
MGI Phenotype PHENOTYPE: Null mutant mice are healthy and are indistinguishable from control littermates with respect to body weight and life span when aged up to one year. No increased spontaneous tumor load was observed. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 46 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2010109A12Rik A G 5: 93,206,575 probably benign Het
4930563M21Rik C T 9: 55,989,476 V283I possibly damaging Het
4933408B17Rik T A 18: 34,580,841 M244L probably benign Het
Acot11 C T 4: 106,760,130 G240R probably damaging Het
Allc T A 12: 28,557,389 H288L probably damaging Het
Atg16l1 T C 1: 87,774,854 I279T possibly damaging Het
Atp6v1b1 A G 6: 83,751,875 probably benign Het
Barhl1 G A 2: 28,915,483 P66L probably benign Het
Cfap58 A T 19: 47,955,417 D352V probably benign Het
Cyp3a44 T A 5: 145,794,971 K122* probably null Het
Dnaic1 G T 4: 41,625,308 R424L probably benign Het
Dync1li2 G T 8: 104,440,535 H79Q probably damaging Het
Fem1b A G 9: 62,796,733 V415A possibly damaging Het
Fgb C T 3: 83,046,787 S48N possibly damaging Het
Gm5624 T C 14: 44,561,875 D31G possibly damaging Het
Gm8909 A T 17: 36,165,730 V284E probably damaging Het
Gzmn T A 14: 56,165,975 I226F probably damaging Het
Il31ra T C 13: 112,547,368 S184G probably damaging Het
Insrr C T 3: 87,813,566 R1044C probably damaging Het
Kcnj15 A G 16: 95,296,334 S272G probably damaging Het
Kcnk16 C T 14: 20,262,929 A106T probably benign Het
Kmt2b A G 7: 30,584,559 V876A probably damaging Het
Maml2 A T 9: 13,621,551 probably benign Het
Me1 A G 9: 86,582,798 L533P possibly damaging Het
Muc16 A G 9: 18,566,690 probably null Het
Nova2 C A 7: 18,958,494 T516K probably damaging Het
Olfr365 T A 2: 37,202,106 N288K probably damaging Het
Olfr657 T C 7: 104,635,887 I71T probably damaging Het
Otogl G A 10: 107,777,117 silent Het
Ppp2r1a T A 17: 20,955,825 V103E probably benign Het
Prl3d3 G A 13: 27,157,164 probably null Het
Rhbdf1 G T 11: 32,214,042 A288E possibly damaging Het
Rnf213 T C 11: 119,430,321 S1202P possibly damaging Het
Slc25a17 A G 15: 81,337,953 V106A probably benign Het
Slc4a4 T G 5: 89,170,765 S640A probably benign Het
Smc4 T A 3: 69,016,772 Y298N probably damaging Het
Tek G T 4: 94,853,495 G830* probably null Het
Tgfb1 A T 7: 25,689,162 probably benign Het
Themis T C 10: 28,781,907 I157T probably damaging Het
Trmt12 A G 15: 58,872,665 probably benign Het
Trrap T C 5: 144,856,950 W3654R probably damaging Het
Tspan3 C T 9: 56,147,440 G108S probably damaging Het
Ugt1a10 T A 1: 88,056,257 probably null Het
Vps13b A G 15: 35,770,683 K2091E probably benign Het
Wdr62 A T 7: 30,271,620 V184D probably damaging Het
Zfp958 C A 8: 4,628,247 Q90K probably benign Het
Other mutations in Large2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01143:Large2 APN 2 92366339 missense probably damaging 1.00
IGL01152:Large2 APN 2 92370639 missense probably damaging 1.00
IGL01377:Large2 APN 2 92369331 missense probably damaging 1.00
IGL01764:Large2 APN 2 92367186 splice site probably benign
IGL02016:Large2 APN 2 92369543 missense possibly damaging 0.82
IGL02396:Large2 APN 2 92366323 nonsense probably null
IGL02996:Large2 APN 2 92365928 missense possibly damaging 0.88
IGL03011:Large2 APN 2 92367582 missense probably damaging 1.00
egged UTSW 2 92370508 intron probably benign
P0041:Large2 UTSW 2 92367254 splice site probably benign
R1915:Large2 UTSW 2 92365825 splice site probably benign
R4193:Large2 UTSW 2 92365359 missense probably damaging 1.00
R4239:Large2 UTSW 2 92366605 splice site probably benign
R4580:Large2 UTSW 2 92370612 missense possibly damaging 0.66
R4679:Large2 UTSW 2 92367558 missense probably benign 0.31
R4857:Large2 UTSW 2 92366634 intron probably benign
R4918:Large2 UTSW 2 92366107 intron probably benign
R5050:Large2 UTSW 2 92367779 missense probably benign 0.05
R5237:Large2 UTSW 2 92367142 missense probably benign 0.16
R5264:Large2 UTSW 2 92374743 unclassified probably benign
R5508:Large2 UTSW 2 92369903 missense possibly damaging 0.80
R5999:Large2 UTSW 2 92366058 missense probably benign 0.01
R6077:Large2 UTSW 2 92366570 missense probably benign 0.00
R6167:Large2 UTSW 2 92367088 missense probably benign 0.44
R6218:Large2 UTSW 2 92370636 missense probably damaging 0.99
R6225:Large2 UTSW 2 92366480 missense probably damaging 1.00
R6301:Large2 UTSW 2 92369516 missense probably damaging 1.00
R6376:Large2 UTSW 2 92370508 intron probably benign
R6485:Large2 UTSW 2 92366028 missense probably benign
R6942:Large2 UTSW 2 92370822 missense probably damaging 0.99
R7051:Large2 UTSW 2 92367022 missense probably damaging 0.97
R7318:Large2 UTSW 2 92366028 missense probably benign
R7581:Large2 UTSW 2 92370193 missense probably damaging 1.00
R7640:Large2 UTSW 2 92374705 start codon destroyed probably null
Z1176:Large2 UTSW 2 92370198 missense probably benign 0.00
Predicted Primers PCR Primer
(F):5'- GTCCATCTGAAAAGACACGTG -3'
(R):5'- TAGTTCGCGATTCTGACCGG -3'

Sequencing Primer
(F):5'- AGGCAGCGGTCACACAG -3'
(R):5'- ATTCTGACCGGGACCTGACTG -3'
Posted On2018-08-01