Incidental Mutation 'R7088:Wac'
ID550048
Institutional Source Beutler Lab
Gene Symbol Wac
Ensembl Gene ENSMUSG00000024283
Gene NameWW domain containing adaptor with coiled-coil
Synonyms1110067P07Rik, A230035H12Rik, Wwp4
MMRRC Submission
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R7088 (G1)
Quality Score225.009
Status Validated
Chromosome18
Chromosomal Location7868832-7973547 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to A at 7921455 bp
ZygosityHeterozygous
Amino Acid Change Histidine to Glutamine at position 530 (H530Q)
Ref Sequence ENSEMBL: ENSMUSP00000132117 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000074919] [ENSMUST00000092112] [ENSMUST00000167020] [ENSMUST00000169478] [ENSMUST00000171042] [ENSMUST00000171486] [ENSMUST00000172018]
Predicted Effect probably damaging
Transcript: ENSMUST00000074919
AA Change: H485Q

PolyPhen 2 Score 0.991 (Sensitivity: 0.71; Specificity: 0.97)
SMART Domains Protein: ENSMUSP00000074454
Gene: ENSMUSG00000024283
AA Change: H485Q

DomainStartEndE-ValueType
low complexity region 55 77 N/A INTRINSIC
WW 85 117 2.12e-7 SMART
low complexity region 207 222 N/A INTRINSIC
low complexity region 287 307 N/A INTRINSIC
low complexity region 320 331 N/A INTRINSIC
low complexity region 466 481 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000092112
AA Change: H427Q

PolyPhen 2 Score 0.990 (Sensitivity: 0.72; Specificity: 0.97)
SMART Domains Protein: ENSMUSP00000089746
Gene: ENSMUSG00000024283
AA Change: H427Q

DomainStartEndE-ValueType
low complexity region 100 122 N/A INTRINSIC
WW 130 162 2.12e-7 SMART
low complexity region 229 249 N/A INTRINSIC
low complexity region 262 273 N/A INTRINSIC
low complexity region 408 423 N/A INTRINSIC
Predicted Effect
SMART Domains Protein: ENSMUSP00000126815
Gene: ENSMUSG00000024283
AA Change: H283Q

DomainStartEndE-ValueType
low complexity region 20 42 N/A INTRINSIC
WW 50 82 2.12e-7 SMART
low complexity region 265 280 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000167020
AA Change: H530Q

PolyPhen 2 Score 0.991 (Sensitivity: 0.71; Specificity: 0.97)
SMART Domains Protein: ENSMUSP00000132117
Gene: ENSMUSG00000024283
AA Change: H530Q

DomainStartEndE-ValueType
low complexity region 100 122 N/A INTRINSIC
WW 130 162 2.12e-7 SMART
low complexity region 252 267 N/A INTRINSIC
low complexity region 332 352 N/A INTRINSIC
low complexity region 365 376 N/A INTRINSIC
low complexity region 511 526 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000167542
SMART Domains Protein: ENSMUSP00000125989
Gene: ENSMUSG00000024283

DomainStartEndE-ValueType
low complexity region 15 30 N/A INTRINSIC
low complexity region 95 115 N/A INTRINSIC
low complexity region 128 139 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000169478
AA Change: H112Q

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000130467
Gene: ENSMUSG00000024283
AA Change: H112Q

DomainStartEndE-ValueType
low complexity region 94 108 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000171042
AA Change: H378Q

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000133185
Gene: ENSMUSG00000024283
AA Change: H378Q

DomainStartEndE-ValueType
low complexity region 55 77 N/A INTRINSIC
WW 85 117 2.12e-7 SMART
low complexity region 184 204 N/A INTRINSIC
low complexity region 217 228 N/A INTRINSIC
low complexity region 359 374 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000171486
AA Change: H379Q

PolyPhen 2 Score 0.979 (Sensitivity: 0.75; Specificity: 0.96)
SMART Domains Protein: ENSMUSP00000127848
Gene: ENSMUSG00000024283
AA Change: H379Q

DomainStartEndE-ValueType
low complexity region 55 77 N/A INTRINSIC
WW 85 117 2.12e-7 SMART
low complexity region 184 204 N/A INTRINSIC
low complexity region 217 228 N/A INTRINSIC
low complexity region 360 375 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000172018
AA Change: H481Q

PolyPhen 2 Score 0.984 (Sensitivity: 0.74; Specificity: 0.96)
SMART Domains Protein: ENSMUSP00000128321
Gene: ENSMUSG00000024283
AA Change: H481Q

DomainStartEndE-ValueType
low complexity region 55 77 N/A INTRINSIC
WW 85 117 2.12e-7 SMART
low complexity region 207 222 N/A INTRINSIC
low complexity region 287 307 N/A INTRINSIC
low complexity region 320 331 N/A INTRINSIC
low complexity region 463 477 N/A INTRINSIC
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 100.0%
  • 10x: 99.8%
  • 20x: 99.3%
Validation Efficiency 99% (77/78)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene contains a WW domain, which is a protein module found in a wide range of signaling proteins. This domain mediates protein-protein interactions and binds proteins containing short linear peptide motifs that are proline-rich or contain at least one proline. This gene product shares 94% sequence identity with the WAC protein in mouse, however, its exact function is not known. Alternative splicing results in multiple transcript variants. [provided by RefSeq, Dec 2008]
Allele List at MGI
Other mutations in this stock
Total: 78 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700020L24Rik G T 11: 83,440,406 E48* probably null Het
2410089E03Rik C T 15: 8,218,947 T1660M probably benign Het
5830473C10Rik T A 5: 90,572,750 L260* probably null Het
Acaca T C 11: 84,278,957 probably null Het
AI314180 A T 4: 58,849,766 L458I possibly damaging Het
Alkbh3 A G 2: 94,004,752 S83P possibly damaging Het
Ammecr1l T C 18: 31,771,819 S38P probably benign Het
Armc10 T C 5: 21,653,392 V145A probably damaging Het
BC048671 A G 6: 90,303,240 K46R probably null Het
C2cd3 A G 7: 100,416,181 T347A Het
C8b G T 4: 104,793,343 E449D probably benign Het
Camk4 T C 18: 32,939,531 S46P probably benign Het
Ccdc113 G A 8: 95,538,105 R81H probably benign Het
Cd177 A T 7: 24,745,133 C674* probably null Het
Cdc6 T A 11: 98,919,239 V458D probably damaging Het
Cenpo C T 12: 4,215,307 E238K probably benign Het
Ckap2 G T 8: 22,169,866 P533Q possibly damaging Het
Cma1 T A 14: 55,943,816 H44L probably damaging Het
Cmya5 A T 13: 93,091,864 S2239T possibly damaging Het
Cntnap5b T A 1: 100,160,077 I141N probably damaging Het
Col6a4 T A 9: 106,000,686 T2031S possibly damaging Het
Cxcr5 T A 9: 44,513,386 T325S possibly damaging Het
Dhx32 A T 7: 133,742,688 L204Q probably damaging Het
Dse A G 10: 34,153,889 Y402H probably damaging Het
Exoc6 G T 19: 37,577,010 C178F probably damaging Het
Fam149a A G 8: 45,350,545 V384A probably benign Het
Fcrl5 T C 3: 87,457,834 *597Q probably null Het
Fer1l6 A G 15: 58,564,050 K431E possibly damaging Het
Fmo3 T A 1: 162,968,865 H46L probably benign Het
Gcm2 T C 13: 41,103,364 D303G probably damaging Het
Gk2 T C 5: 97,455,675 M435V probably damaging Het
Gli1 C A 10: 127,335,999 M295I probably damaging Het
Gm11444 G T 11: 85,847,036 H109Q Het
Gtpbp1 T A 15: 79,719,282 D182E Het
Hnf4g A T 3: 3,648,125 probably null Het
Hsf2 G A 10: 57,512,092 R483H probably damaging Het
Kcnq4 C T 4: 120,704,399 R491H probably damaging Het
Lama3 T C 18: 12,582,545 V1686A possibly damaging Het
Larp6 A G 9: 60,724,355 K137E probably damaging Het
Mboat1 T G 13: 30,195,789 probably null Het
Mdh1 T C 11: 21,558,484 Y286C probably damaging Het
Mga G T 2: 119,961,936 K2607N probably damaging Het
Morf4l1 C A 9: 90,097,380 V183F possibly damaging Het
Mroh4 G A 15: 74,626,144 R196W probably benign Het
Muc16 C A 9: 18,592,680 M6438I probably damaging Het
Myom3 A G 4: 135,803,278 Y1167C probably damaging Het
Neurl3 T C 1: 36,269,221 E170G possibly damaging Het
Nsd3 T C 8: 25,666,034 I539T probably benign Het
Nup155 T C 15: 8,156,693 F1313S probably benign Het
Nxn A T 11: 76,263,148 V287E possibly damaging Het
Olfr1253 G A 2: 89,752,099 T243I probably benign Het
Olfr1354 A C 10: 78,917,759 L306F probably benign Het
Olfr891 C A 9: 38,180,452 V124F probably damaging Het
Pax6 A G 2: 105,696,408 N220D probably benign Het
Pcdha11 G A 18: 37,005,417 R33H probably benign Het
Pdzd8 A G 19: 59,344,957 F211L probably damaging Het
Pear1 C A 3: 87,754,638 V477F possibly damaging Het
Pex19 GTCTCTTGTCTCCGAAGGTGCTCTTGATGATTTCTCTTGTCTCCGAAGGTGCTCTTGATGATTTC GTCTCTTGTCTCCGAAGGTGCTCTTGATGATTTC 1: 172,128,583 probably null Het
Pidd1 A T 7: 141,440,487 V539E probably damaging Het
Ptprg A T 14: 12,207,365 I878F probably damaging Het
Rabepk T C 2: 34,785,699 T140A probably benign Het
Ranbp2 G T 10: 58,463,906 R454L probably damaging Het
Rnf123 C T 9: 108,058,536 R943Q probably null Het
Sash1 G A 10: 8,729,717 R970* probably null Het
Serpinb2 C A 1: 107,524,692 F333L probably damaging Het
Shank3 T A 15: 89,503,525 probably null Het
Slc9a2 A C 1: 40,726,379 I310L probably damaging Het
Strip2 T A 6: 29,920,533 probably null Het
Thoc3 T C 13: 54,463,752 T241A probably damaging Het
Tmem139 T A 6: 42,263,265 V2E probably damaging Het
Usp24 G T 4: 106,387,546 V1233F probably damaging Het
Vnn1 A G 10: 23,900,747 Q332R probably benign Het
Wdr35 T A 12: 8,978,659 N92K probably benign Het
Zbtb18 T G 1: 177,447,254 L60R probably damaging Het
Zfp184 T A 13: 21,959,992 C623S probably damaging Het
Zfp292 A G 4: 34,806,796 Y2088H probably damaging Het
Zfp975 G T 7: 42,662,672 S172R probably benign Het
Zswim2 G A 2: 83,915,727 Q456* probably null Het
Other mutations in Wac
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL02404:Wac APN 18 7917570 missense probably damaging 1.00
R1077:Wac UTSW 18 7921916 missense probably damaging 1.00
R2915:Wac UTSW 18 7926131 missense possibly damaging 0.96
R3196:Wac UTSW 18 7917568 missense probably damaging 1.00
R3793:Wac UTSW 18 7920190 missense possibly damaging 0.86
R3840:Wac UTSW 18 7918535 missense probably damaging 1.00
R3971:Wac UTSW 18 7916175 missense probably damaging 1.00
R6402:Wac UTSW 18 7901585 missense possibly damaging 0.71
R6429:Wac UTSW 18 7920163 missense probably damaging 0.97
R6536:Wac UTSW 18 7905189 unclassified probably null
R6615:Wac UTSW 18 7868884 unclassified probably null
R6645:Wac UTSW 18 7973523 missense probably damaging 1.00
R7464:Wac UTSW 18 7871746 critical splice donor site probably null
R7760:Wac UTSW 18 7921913 missense probably benign 0.43
X0066:Wac UTSW 18 7916298 critical splice donor site probably null
Z1176:Wac UTSW 18 7973531 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- CTCTAATGTTCCAAACGCTGTTG -3'
(R):5'- ACGAGGGAGAGATATACCTGTTTC -3'

Sequencing Primer
(F):5'- GTTCCAAACGCTGTTGAGTAATAC -3'
(R):5'- AGAGATATACCTGTTTCTCTGCG -3'
Posted On2019-05-15