Incidental Mutation 'R7088:Gcm2'
ID550038
Institutional Source Beutler Lab
Gene Symbol Gcm2
Ensembl Gene ENSMUSG00000021362
Gene Nameglial cells missing homolog 2
SynonymsGcm1-rs2
MMRRC Submission
Accession Numbers
Is this an essential gene? Possibly non essential (E-score: 0.455) question?
Stock #R7088 (G1)
Quality Score225.009
Status Validated
Chromosome13
Chromosomal Location41101427-41111035 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 41103364 bp
ZygosityHeterozygous
Amino Acid Change Aspartic acid to Glycine at position 303 (D303G)
Ref Sequence ENSEMBL: ENSMUSP00000021791 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000021791] [ENSMUST00000225271]
Predicted Effect probably damaging
Transcript: ENSMUST00000021791
AA Change: D303G

PolyPhen 2 Score 0.983 (Sensitivity: 0.75; Specificity: 0.96)
SMART Domains Protein: ENSMUSP00000021791
Gene: ENSMUSG00000021362
AA Change: D303G

DomainStartEndE-ValueType
Pfam:GCM 35 172 4.8e-74 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000225271
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 100.0%
  • 10x: 99.8%
  • 20x: 99.3%
Validation Efficiency 99% (77/78)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene is a homolog of the Drosophila glial cells missing gene, which is thought to act as a binary switch between neuronal and glial cell determination. The protein encoded by this gene contains a conserved N-terminal GCM motif that has DNA-binding activity. The protein is a transcription factor that acts as a master regulator of parathyroid development. It has been suggested that this transcription factor might mediate the effect of calcium on parathyroid hormone expression and secretion in parathyroid cells. Mutations in this gene are associated with hypoparathyroidism. [provided by RefSeq, Jul 2008]
PHENOTYPE: Homozygous null mice lack parathyroid glands and exhibit hypocalcemia, hypophosphatemia, a mild abnormal bone phenotype, and partial perinatal lethality. Hypoparathyroidism is observed although parathyroid hormone serum levels are normal. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 78 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700020L24Rik G T 11: 83,440,406 E48* probably null Het
2410089E03Rik C T 15: 8,218,947 T1660M probably benign Het
5830473C10Rik T A 5: 90,572,750 L260* probably null Het
Acaca T C 11: 84,278,957 probably null Het
AI314180 A T 4: 58,849,766 L458I possibly damaging Het
Alkbh3 A G 2: 94,004,752 S83P possibly damaging Het
Ammecr1l T C 18: 31,771,819 S38P probably benign Het
Armc10 T C 5: 21,653,392 V145A probably damaging Het
BC048671 A G 6: 90,303,240 K46R probably null Het
C2cd3 A G 7: 100,416,181 T347A Het
C8b G T 4: 104,793,343 E449D probably benign Het
Camk4 T C 18: 32,939,531 S46P probably benign Het
Ccdc113 G A 8: 95,538,105 R81H probably benign Het
Cd177 A T 7: 24,745,133 C674* probably null Het
Cdc6 T A 11: 98,919,239 V458D probably damaging Het
Cenpo C T 12: 4,215,307 E238K probably benign Het
Ckap2 G T 8: 22,169,866 P533Q possibly damaging Het
Cma1 T A 14: 55,943,816 H44L probably damaging Het
Cmya5 A T 13: 93,091,864 S2239T possibly damaging Het
Cntnap5b T A 1: 100,160,077 I141N probably damaging Het
Col6a4 T A 9: 106,000,686 T2031S possibly damaging Het
Cxcr5 T A 9: 44,513,386 T325S possibly damaging Het
Dhx32 A T 7: 133,742,688 L204Q probably damaging Het
Dse A G 10: 34,153,889 Y402H probably damaging Het
Exoc6 G T 19: 37,577,010 C178F probably damaging Het
Fam149a A G 8: 45,350,545 V384A probably benign Het
Fcrl5 T C 3: 87,457,834 *597Q probably null Het
Fer1l6 A G 15: 58,564,050 K431E possibly damaging Het
Fmo3 T A 1: 162,968,865 H46L probably benign Het
Gk2 T C 5: 97,455,675 M435V probably damaging Het
Gli1 C A 10: 127,335,999 M295I probably damaging Het
Gm11444 G T 11: 85,847,036 H109Q Het
Gtpbp1 T A 15: 79,719,282 D182E Het
Hnf4g A T 3: 3,648,125 probably null Het
Hsf2 G A 10: 57,512,092 R483H probably damaging Het
Kcnq4 C T 4: 120,704,399 R491H probably damaging Het
Lama3 T C 18: 12,582,545 V1686A possibly damaging Het
Larp6 A G 9: 60,724,355 K137E probably damaging Het
Mboat1 T G 13: 30,195,789 probably null Het
Mdh1 T C 11: 21,558,484 Y286C probably damaging Het
Mga G T 2: 119,961,936 K2607N probably damaging Het
Morf4l1 C A 9: 90,097,380 V183F possibly damaging Het
Mroh4 G A 15: 74,626,144 R196W probably benign Het
Muc16 C A 9: 18,592,680 M6438I probably damaging Het
Myom3 A G 4: 135,803,278 Y1167C probably damaging Het
Neurl3 T C 1: 36,269,221 E170G possibly damaging Het
Nsd3 T C 8: 25,666,034 I539T probably benign Het
Nup155 T C 15: 8,156,693 F1313S probably benign Het
Nxn A T 11: 76,263,148 V287E possibly damaging Het
Olfr1253 G A 2: 89,752,099 T243I probably benign Het
Olfr1354 A C 10: 78,917,759 L306F probably benign Het
Olfr891 C A 9: 38,180,452 V124F probably damaging Het
Pax6 A G 2: 105,696,408 N220D probably benign Het
Pcdha11 G A 18: 37,005,417 R33H probably benign Het
Pdzd8 A G 19: 59,344,957 F211L probably damaging Het
Pear1 C A 3: 87,754,638 V477F possibly damaging Het
Pex19 GTCTCTTGTCTCCGAAGGTGCTCTTGATGATTTCTCTTGTCTCCGAAGGTGCTCTTGATGATTTC GTCTCTTGTCTCCGAAGGTGCTCTTGATGATTTC 1: 172,128,583 probably null Het
Pidd1 A T 7: 141,440,487 V539E probably damaging Het
Ptprg A T 14: 12,207,365 I878F probably damaging Het
Rabepk T C 2: 34,785,699 T140A probably benign Het
Ranbp2 G T 10: 58,463,906 R454L probably damaging Het
Rnf123 C T 9: 108,058,536 R943Q probably null Het
Sash1 G A 10: 8,729,717 R970* probably null Het
Serpinb2 C A 1: 107,524,692 F333L probably damaging Het
Shank3 T A 15: 89,503,525 probably null Het
Slc9a2 A C 1: 40,726,379 I310L probably damaging Het
Strip2 T A 6: 29,920,533 probably null Het
Thoc3 T C 13: 54,463,752 T241A probably damaging Het
Tmem139 T A 6: 42,263,265 V2E probably damaging Het
Usp24 G T 4: 106,387,546 V1233F probably damaging Het
Vnn1 A G 10: 23,900,747 Q332R probably benign Het
Wac T A 18: 7,921,455 H530Q probably damaging Het
Wdr35 T A 12: 8,978,659 N92K probably benign Het
Zbtb18 T G 1: 177,447,254 L60R probably damaging Het
Zfp184 T A 13: 21,959,992 C623S probably damaging Het
Zfp292 A G 4: 34,806,796 Y2088H probably damaging Het
Zfp975 G T 7: 42,662,672 S172R probably benign Het
Zswim2 G A 2: 83,915,727 Q456* probably null Het
Other mutations in Gcm2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01312:Gcm2 APN 13 41103131 missense probably damaging 1.00
IGL01476:Gcm2 APN 13 41105741 missense probably damaging 1.00
IGL02034:Gcm2 APN 13 41105793 missense probably damaging 1.00
IGL02186:Gcm2 APN 13 41104649 missense possibly damaging 0.93
IGL02456:Gcm2 APN 13 41103001 missense probably benign 0.01
IGL03142:Gcm2 APN 13 41103235 missense probably benign 0.01
IGL03184:Gcm2 APN 13 41105412 missense probably damaging 1.00
PIT4403001:Gcm2 UTSW 13 41102839 missense probably benign 0.01
R0227:Gcm2 UTSW 13 41105856 missense probably damaging 0.99
R1061:Gcm2 UTSW 13 41105871 missense probably damaging 1.00
R1813:Gcm2 UTSW 13 41105891 missense probably benign 0.19
R2057:Gcm2 UTSW 13 41109954 start codon destroyed probably null 0.28
R2058:Gcm2 UTSW 13 41109954 start codon destroyed probably null 0.28
R2059:Gcm2 UTSW 13 41109954 start codon destroyed probably null 0.28
R2351:Gcm2 UTSW 13 41103618 missense probably benign 0.02
R4653:Gcm2 UTSW 13 41102841 missense probably benign 0.21
R4782:Gcm2 UTSW 13 41103494 missense possibly damaging 0.66
R4799:Gcm2 UTSW 13 41103494 missense possibly damaging 0.66
R5135:Gcm2 UTSW 13 41102959 missense probably benign
R5162:Gcm2 UTSW 13 41103655 missense probably benign 0.01
R5665:Gcm2 UTSW 13 41109911 missense possibly damaging 0.73
R5756:Gcm2 UTSW 13 41109896 missense probably damaging 1.00
R5771:Gcm2 UTSW 13 41103515 missense probably benign 0.40
R5928:Gcm2 UTSW 13 41103398 missense probably benign 0.00
R5977:Gcm2 UTSW 13 41103127 missense probably damaging 0.99
R6394:Gcm2 UTSW 13 41109897 missense probably damaging 1.00
R6578:Gcm2 UTSW 13 41105678 missense probably damaging 1.00
R6798:Gcm2 UTSW 13 41105885 missense probably damaging 1.00
R7413:Gcm2 UTSW 13 41105754 missense probably damaging 1.00
R7456:Gcm2 UTSW 13 41103275 missense probably benign 0.02
Z1088:Gcm2 UTSW 13 41102792 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- TAAGGCAATGTGGGCACAGC -3'
(R):5'- GATACCAGCTTCCCTATTCCAGG -3'

Sequencing Primer
(F):5'- AGCCTGGCATTGCTCACAG -3'
(R):5'- GATGTCTACAGAGTTACCTGTGACC -3'
Posted On2019-05-15