Incidental Mutation 'R7137:Insc'
ID553132
Institutional Source Beutler Lab
Gene Symbol Insc
Ensembl Gene ENSMUSG00000048782
Gene NameINSC spindle orientation adaptor protein
SynonymsInscuteable, 3830422K02Rik
MMRRC Submission
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.165) question?
Stock #R7137 (G1)
Quality Score225.009
Status Not validated
Chromosome7
Chromosomal Location114743694-114850383 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) G to A at 114811615 bp
ZygosityHeterozygous
Amino Acid Change Valine to Isoleucine at position 236 (V236I)
Ref Sequence ENSEMBL: ENSMUSP00000112682 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000117543] [ENSMUST00000169913] [ENSMUST00000206274]
Predicted Effect probably benign
Transcript: ENSMUST00000117543
AA Change: V236I

PolyPhen 2 Score 0.209 (Sensitivity: 0.92; Specificity: 0.88)
SMART Domains Protein: ENSMUSP00000112682
Gene: ENSMUSG00000048782
AA Change: V236I

DomainStartEndE-ValueType
Pfam:INSC_LBD 23 69 8.3e-34 PFAM
SCOP:d1jdha_ 151 497 6e-9 SMART
Blast:ARM 263 286 2e-7 BLAST
Blast:ARM 401 452 7e-21 BLAST
Blast:ARM 453 483 2e-7 BLAST
Predicted Effect probably benign
Transcript: ENSMUST00000169913
AA Change: V236I

PolyPhen 2 Score 0.209 (Sensitivity: 0.92; Specificity: 0.88)
SMART Domains Protein: ENSMUSP00000129505
Gene: ENSMUSG00000048782
AA Change: V236I

DomainStartEndE-ValueType
PDB:3SF4|F 20 59 1e-17 PDB
low complexity region 60 78 N/A INTRINSIC
SCOP:d1jdha_ 151 497 6e-9 SMART
Blast:ARM 263 286 2e-7 BLAST
Blast:ARM 401 452 7e-21 BLAST
Blast:ARM 453 483 2e-7 BLAST
Predicted Effect probably benign
Transcript: ENSMUST00000206274
Meta Mutation Damage Score 0.0707 question?
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.6%
  • 20x: 98.9%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] In Drosophila, neuroblasts divide asymmetrically into another neuroblast at the apical side and a smaller ganglion mother cell on the basal side. Cell polarization is precisely regulated by 2 apically localized multiprotein signaling complexes that are tethered by Inscuteable, which regulates their apical localization (Izaki et al., 2006 [PubMed 16458856]).[supplied by OMIM, Mar 2008]
PHENOTYPE: Homozygous inactivation of this gene leads to abnormal cochlear hair cell morphology. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 51 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
A2m T C 6: 121,677,985 S1423P possibly damaging Het
Acvr1c A G 2: 58,283,387 probably null Het
Adgrf5 A G 17: 43,450,897 K1161R probably damaging Het
Arhgap32 T G 9: 32,151,936 D80E probably benign Het
Aspg T C 12: 112,112,198 V30A possibly damaging Het
Bcl2a1d T C 9: 88,731,478 D81G probably damaging Het
Cep170b T C 12: 112,735,167 V160A probably benign Het
Ces1c T C 8: 93,130,842 Y37C probably benign Het
Cntnap5a T C 1: 116,089,376 L233P probably damaging Het
Crem C A 18: 3,273,459 A245S possibly damaging Het
Cyp2d12 C T 15: 82,557,821 A280V probably benign Het
Dnah2 C T 11: 69,491,555 G1243D probably damaging Het
Emcn T G 3: 137,403,991 N131K probably damaging Het
Fat3 A T 9: 15,997,148 D2519E probably damaging Het
Fibin T A 2: 110,362,656 D47V probably damaging Het
Fsd1 G A 17: 55,993,876 R245H probably damaging Het
Gimap8 C A 6: 48,650,253 L54I probably damaging Het
Gm20481 A G 17: 34,970,095 Y27C unknown Het
Gm21319 A T 12: 87,773,546 L81Q possibly damaging Het
Grin1 T G 2: 25,313,538 M154L probably benign Het
Ighv8-13 A G 12: 115,765,577 L20P probably damaging Het
Lrrk1 A G 7: 66,285,279 F1031L probably benign Het
Man2a2 C A 7: 80,359,751 R785L probably benign Het
Mcur1 C A 13: 43,544,455 probably null Het
Med12l A C 3: 59,258,254 R1464S probably damaging Het
Mycbp2 A T 14: 103,282,679 M767K possibly damaging Het
Naalad2 T C 9: 18,323,487 I762V probably benign Het
Nfkbid A G 7: 30,426,256 T357A possibly damaging Het
Pcdh17 A G 14: 84,533,549 R1156G possibly damaging Het
Pcdhb1 T C 18: 37,267,392 S799P possibly damaging Het
Pde3a A T 6: 141,498,746 E1093D probably benign Het
Plcg1 T C 2: 160,753,926 Y572H possibly damaging Het
Plxna4 A G 6: 32,517,264 L139P probably damaging Het
Psma1 A G 7: 114,274,448 Y6H probably damaging Het
Psmd2 A G 16: 20,652,627 E76G probably benign Het
Ptk2 G A 15: 73,221,809 P854S possibly damaging Het
Pyy T G 11: 102,107,273 D27A possibly damaging Het
Slc22a2 A G 17: 12,584,341 T21A probably benign Het
Slc25a2 T C 18: 37,638,147 I110V probably benign Het
Sult1c2 A C 17: 53,838,394 W85G probably damaging Het
Svs1 A G 6: 48,990,149 Y677C probably damaging Het
Syt12 C T 19: 4,453,950 D218N probably damaging Het
Tln1 C T 4: 43,540,616 V1462M probably damaging Het
Tor1aip2 T A 1: 156,051,976 N33K possibly damaging Het
Usp17lb C A 7: 104,841,591 W43L probably benign Het
Vmn1r76 A G 7: 11,930,685 Y201H possibly damaging Het
Wnk1 C A 6: 120,038,212 probably benign Het
Wrnip1 A G 13: 32,802,749 D171G probably benign Het
Zar1 T A 5: 72,580,816 N81I probably damaging Het
Zbtb45 T C 7: 13,007,156 T392A probably benign Het
Zfp445 T C 9: 122,854,778 E272G probably damaging Het
Other mutations in Insc
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00795:Insc APN 7 114842154 missense probably damaging 1.00
IGL02381:Insc APN 7 114849942 makesense probably null
IGL02515:Insc APN 7 114769008 missense probably damaging 1.00
IGL03154:Insc APN 7 114842189 missense probably null 1.00
Rare UTSW 7 114791148 missense probably damaging 1.00
R0139:Insc UTSW 7 114769002 missense probably damaging 0.98
R0322:Insc UTSW 7 114792265 missense probably damaging 0.99
R0708:Insc UTSW 7 114845146 missense probably damaging 0.98
R0715:Insc UTSW 7 114845077 missense probably benign 0.06
R1864:Insc UTSW 7 114842178 missense probably benign 0.06
R2069:Insc UTSW 7 114804593 critical splice donor site probably null
R3763:Insc UTSW 7 114790972 missense probably damaging 1.00
R4432:Insc UTSW 7 114769055 intron probably benign
R5331:Insc UTSW 7 114845038 missense probably damaging 0.97
R5346:Insc UTSW 7 114804541 missense possibly damaging 0.69
R5625:Insc UTSW 7 114829067 missense probably damaging 0.99
R5715:Insc UTSW 7 114849841 missense probably benign 0.04
R5860:Insc UTSW 7 114791148 missense probably damaging 1.00
R6199:Insc UTSW 7 114791166 splice site probably null
R7440:Insc UTSW 7 114845043 missense possibly damaging 0.78
R7474:Insc UTSW 7 114768823 critical splice donor site probably null
R7504:Insc UTSW 7 114791298 critical splice donor site probably null
R7964:Insc UTSW 7 114846473 missense probably damaging 1.00
R7981:Insc UTSW 7 114829067 missense probably damaging 0.99
R7997:Insc UTSW 7 114845137 missense probably damaging 1.00
Z1176:Insc UTSW 7 114811639 nonsense probably null
Predicted Primers PCR Primer
(F):5'- CCAAAACATCTGTTGCGGGC -3'
(R):5'- TAGAAGCGCATTAGGATAGACC -3'

Sequencing Primer
(F):5'- GGGCCCCCAAACCCTACTTTC -3'
(R):5'- CTATAGGAAGAGGACCAGATGGCTAC -3'
Posted On2019-05-15