Incidental Mutation 'R7137:Dnah2'
ID 553139
Institutional Source Beutler Lab
Gene Symbol Dnah2
Ensembl Gene ENSMUSG00000005237
Gene Name dynein, axonemal, heavy chain 2
Synonyms Dnahc2, Dnhd3, D330014H01Rik, 2900022L05Rik
MMRRC Submission 045248-MU
Accession Numbers
Essential gene? Non essential (E-score: 0.000) question?
Stock # R7137 (G1)
Quality Score 225.009
Status Not validated
Chromosome 11
Chromosomal Location 69420809-69549110 bp(-) (GRCm38)
Type of Mutation missense
DNA Base Change (assembly) C to T at 69491555 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change Glycine to Aspartic acid at position 1243 (G1243D)
Ref Sequence ENSEMBL: ENSMUSP00000104299 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000035539] [ENSMUST00000108659]
AlphaFold no structure available at present
Predicted Effect possibly damaging
Transcript: ENSMUST00000035539
AA Change: G1243D

PolyPhen 2 Score 0.468 (Sensitivity: 0.89; Specificity: 0.90)
SMART Domains Protein: ENSMUSP00000047329
Gene: ENSMUSG00000005237
AA Change: G1243D

DomainStartEndE-ValueType
low complexity region 4 25 N/A INTRINSIC
Pfam:DHC_N1 273 429 6.6e-37 PFAM
Pfam:DHC_N1 432 761 1.3e-54 PFAM
Pfam:DHC_N2 1253 1668 3.4e-144 PFAM
AAA 1826 1962 2.95e-1 SMART
Pfam:AAA_5 2108 2251 1.3e-5 PFAM
AAA 2437 2584 3.63e-5 SMART
Pfam:AAA_8 2752 3022 1.1e-75 PFAM
Pfam:MT 3034 3370 8.7e-55 PFAM
Pfam:AAA_9 3386 3616 7.4e-68 PFAM
Pfam:Dynein_heavy 3748 4453 1.2e-220 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000108659
AA Change: G1243D

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000104299
Gene: ENSMUSG00000005237
AA Change: G1243D

DomainStartEndE-ValueType
low complexity region 4 25 N/A INTRINSIC
Pfam:DHC_N1 274 429 1.1e-47 PFAM
Pfam:DHC_N1 438 760 1.5e-75 PFAM
Pfam:DHC_N2 1255 1666 4.4e-144 PFAM
low complexity region 1711 1720 N/A INTRINSIC
AAA 1832 1968 2.95e-1 SMART
Blast:AAA 2111 2251 2e-86 BLAST
AAA 2443 2590 3.63e-5 SMART
Pfam:AAA_8 2758 3028 5.5e-77 PFAM
Pfam:MT 3040 3376 7.6e-55 PFAM
Pfam:AAA_9 3396 3621 7.5e-94 PFAM
Pfam:Dynein_heavy 3759 4458 4.9e-264 PFAM
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.6%
  • 20x: 98.9%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] Dyneins are microtubule-associated motor protein complexes composed of several heavy, light, and intermediate chains. The axonemal dyneins, found in cilia and flagella, are components of the outer and inner dynein arms attached to the peripheral microtubule doublets. DNAH2 is an axonemal inner arm dynein heavy chain (Chapelin et al., 1997 [PubMed 9256245]).[supplied by OMIM, Mar 2008]
Allele List at MGI
Other mutations in this stock
Total: 51 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
A2m T C 6: 121,677,985 (GRCm38) S1423P possibly damaging Het
Acvr1c A G 2: 58,283,387 (GRCm38) probably null Het
Adgrf5 A G 17: 43,450,897 (GRCm38) K1161R probably damaging Het
Arhgap32 T G 9: 32,151,936 (GRCm38) D80E probably benign Het
Aspg T C 12: 112,112,198 (GRCm38) V30A possibly damaging Het
Bcl2a1d T C 9: 88,731,478 (GRCm38) D81G probably damaging Het
Cep170b T C 12: 112,735,167 (GRCm38) V160A probably benign Het
Ces1c T C 8: 93,130,842 (GRCm38) Y37C probably benign Het
Cntnap5a T C 1: 116,089,376 (GRCm38) L233P probably damaging Het
Crem C A 18: 3,273,459 (GRCm38) A245S possibly damaging Het
Cyp2d12 C T 15: 82,557,821 (GRCm38) A280V probably benign Het
Emcn T G 3: 137,403,991 (GRCm38) N131K probably damaging Het
Fat3 A T 9: 15,997,148 (GRCm38) D2519E probably damaging Het
Fibin T A 2: 110,362,656 (GRCm38) D47V probably damaging Het
Fsd1 G A 17: 55,993,876 (GRCm38) R245H probably damaging Het
Gimap8 C A 6: 48,650,253 (GRCm38) L54I probably damaging Het
Gm20481 A G 17: 34,970,095 (GRCm38) Y27C unknown Het
Gm21319 A T 12: 87,773,546 (GRCm38) L81Q possibly damaging Het
Grin1 T G 2: 25,313,538 (GRCm38) M154L probably benign Het
Ighv8-13 A G 12: 115,765,577 (GRCm38) L20P probably damaging Het
Insc G A 7: 114,811,615 (GRCm38) V236I probably benign Het
Lrrk1 A G 7: 66,285,279 (GRCm38) F1031L probably benign Het
Man2a2 C A 7: 80,359,751 (GRCm38) R785L probably benign Het
Mcur1 C A 13: 43,544,455 (GRCm38) probably null Het
Med12l A C 3: 59,258,254 (GRCm38) R1464S probably damaging Het
Mycbp2 A T 14: 103,282,679 (GRCm38) M767K possibly damaging Het
Naalad2 T C 9: 18,323,487 (GRCm38) I762V probably benign Het
Nfkbid A G 7: 30,426,256 (GRCm38) T357A possibly damaging Het
Pcdh17 A G 14: 84,533,549 (GRCm38) R1156G possibly damaging Het
Pcdhb1 T C 18: 37,267,392 (GRCm38) S799P possibly damaging Het
Pde3a A T 6: 141,498,746 (GRCm38) E1093D probably benign Het
Plcg1 T C 2: 160,753,926 (GRCm38) Y572H possibly damaging Het
Plxna4 A G 6: 32,517,264 (GRCm38) L139P probably damaging Het
Psma1 A G 7: 114,274,448 (GRCm38) Y6H probably damaging Het
Psmd2 A G 16: 20,652,627 (GRCm38) E76G probably benign Het
Ptk2 G A 15: 73,221,809 (GRCm38) P854S possibly damaging Het
Pyy T G 11: 102,107,273 (GRCm38) D27A possibly damaging Het
Slc22a2 A G 17: 12,584,341 (GRCm38) T21A probably benign Het
Slc25a2 T C 18: 37,638,147 (GRCm38) I110V probably benign Het
Sult1c2 A C 17: 53,838,394 (GRCm38) W85G probably damaging Het
Svs1 A G 6: 48,990,149 (GRCm38) Y677C probably damaging Het
Syt12 C T 19: 4,453,950 (GRCm38) D218N probably damaging Het
Tln1 C T 4: 43,540,616 (GRCm38) V1462M probably damaging Het
Tor1aip2 T A 1: 156,051,976 (GRCm38) N33K possibly damaging Het
Usp17lb C A 7: 104,841,591 (GRCm38) W43L probably benign Het
Vmn1r76 A G 7: 11,930,685 (GRCm38) Y201H possibly damaging Het
Wnk1 C A 6: 120,038,212 (GRCm38) probably benign Het
Wrnip1 A G 13: 32,802,749 (GRCm38) D171G probably benign Het
Zar1 T A 5: 72,580,816 (GRCm38) N81I probably damaging Het
Zbtb45 T C 7: 13,007,156 (GRCm38) T392A probably benign Het
Zfp445 T C 9: 122,854,778 (GRCm38) E272G probably damaging Het
Other mutations in Dnah2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00087:Dnah2 APN 11 69,492,672 (GRCm38) missense possibly damaging 0.93
IGL00418:Dnah2 APN 11 69,495,066 (GRCm38) splice site probably benign
IGL00772:Dnah2 APN 11 69,451,257 (GRCm38) missense probably damaging 0.97
IGL00819:Dnah2 APN 11 69,473,350 (GRCm38) critical splice donor site probably null
IGL00827:Dnah2 APN 11 69,448,457 (GRCm38) missense probably damaging 1.00
IGL01060:Dnah2 APN 11 69,478,092 (GRCm38) missense possibly damaging 0.86
IGL01340:Dnah2 APN 11 69,493,184 (GRCm38) missense probably damaging 0.99
IGL01349:Dnah2 APN 11 69,475,606 (GRCm38) missense probably damaging 0.99
IGL01413:Dnah2 APN 11 69,432,964 (GRCm38) missense probably damaging 0.99
IGL01451:Dnah2 APN 11 69,474,191 (GRCm38) splice site probably benign
IGL01480:Dnah2 APN 11 69,458,371 (GRCm38) missense possibly damaging 0.91
IGL01537:Dnah2 APN 11 69,516,080 (GRCm38) missense probably benign 0.17
IGL01592:Dnah2 APN 11 69,431,087 (GRCm38) missense probably benign 0.14
IGL01612:Dnah2 APN 11 69,465,063 (GRCm38) splice site probably benign
IGL01667:Dnah2 APN 11 69,544,395 (GRCm38) missense probably benign
IGL01667:Dnah2 APN 11 69,520,941 (GRCm38) missense probably damaging 0.98
IGL01691:Dnah2 APN 11 69,539,443 (GRCm38) missense probably benign
IGL02019:Dnah2 APN 11 69,474,285 (GRCm38) missense probably damaging 1.00
IGL02039:Dnah2 APN 11 69,499,212 (GRCm38) missense probably damaging 1.00
IGL02076:Dnah2 APN 11 69,422,559 (GRCm38) missense probably damaging 0.99
IGL02085:Dnah2 APN 11 69,458,185 (GRCm38) missense probably benign 0.07
IGL02158:Dnah2 APN 11 69,458,123 (GRCm38) missense probably benign
IGL02381:Dnah2 APN 11 69,446,292 (GRCm38) missense probably benign 0.25
IGL02681:Dnah2 APN 11 69,452,933 (GRCm38) missense probably benign 0.40
IGL02957:Dnah2 APN 11 69,448,507 (GRCm38) missense possibly damaging 0.96
IGL02961:Dnah2 APN 11 69,518,414 (GRCm38) missense probably damaging 1.00
IGL02969:Dnah2 APN 11 69,521,187 (GRCm38) missense possibly damaging 0.80
IGL03117:Dnah2 APN 11 69,436,291 (GRCm38) splice site probably benign
IGL03120:Dnah2 APN 11 69,421,848 (GRCm38) missense probably damaging 1.00
IGL03183:Dnah2 APN 11 69,458,488 (GRCm38) missense possibly damaging 0.94
IGL03197:Dnah2 APN 11 69,459,263 (GRCm38) missense probably damaging 1.00
IGL03263:Dnah2 APN 11 69,529,381 (GRCm38) critical splice donor site probably null
IGL03333:Dnah2 APN 11 69,495,123 (GRCm38) missense probably damaging 1.00
IGL03338:Dnah2 APN 11 69,496,577 (GRCm38) missense probably benign 0.13
argyrios UTSW 11 69,516,590 (GRCm38) missense possibly damaging 0.47
Aureus UTSW 11 69,429,348 (GRCm38) missense probably damaging 1.00
platinum UTSW 11 69,458,042 (GRCm38) missense probably damaging 0.96
R0334_dnah2_144 UTSW 11 69,436,836 (GRCm38) missense probably damaging 1.00
R2150_dnah2_212 UTSW 11 69,515,761 (GRCm38) missense probably benign 0.14
BB005:Dnah2 UTSW 11 69,430,835 (GRCm38) missense probably damaging 0.98
BB015:Dnah2 UTSW 11 69,430,835 (GRCm38) missense probably damaging 0.98
E0370:Dnah2 UTSW 11 69,515,615 (GRCm38) splice site probably null
P0026:Dnah2 UTSW 11 69,464,947 (GRCm38) missense probably damaging 1.00
R0133:Dnah2 UTSW 11 69,421,009 (GRCm38) missense probably damaging 1.00
R0190:Dnah2 UTSW 11 69,435,249 (GRCm38) missense probably damaging 1.00
R0334:Dnah2 UTSW 11 69,436,836 (GRCm38) missense probably damaging 1.00
R0359:Dnah2 UTSW 11 69,529,531 (GRCm38) missense probably benign 0.00
R0386:Dnah2 UTSW 11 69,447,861 (GRCm38) missense probably damaging 1.00
R0414:Dnah2 UTSW 11 69,499,238 (GRCm38) missense probably benign 0.26
R0427:Dnah2 UTSW 11 69,452,879 (GRCm38) missense probably damaging 0.99
R0433:Dnah2 UTSW 11 69,459,288 (GRCm38) missense probably damaging 1.00
R0442:Dnah2 UTSW 11 69,448,542 (GRCm38) missense probably damaging 1.00
R0462:Dnah2 UTSW 11 69,459,201 (GRCm38) missense probably damaging 1.00
R0463:Dnah2 UTSW 11 69,423,126 (GRCm38) missense probably damaging 1.00
R0611:Dnah2 UTSW 11 69,499,194 (GRCm38) missense probably damaging 1.00
R0626:Dnah2 UTSW 11 69,477,683 (GRCm38) missense probably benign 0.07
R0924:Dnah2 UTSW 11 69,421,308 (GRCm38) missense probably damaging 1.00
R0968:Dnah2 UTSW 11 69,448,519 (GRCm38) missense possibly damaging 0.67
R1066:Dnah2 UTSW 11 69,447,819 (GRCm38) missense probably damaging 1.00
R1183:Dnah2 UTSW 11 69,446,648 (GRCm38) missense possibly damaging 0.95
R1184:Dnah2 UTSW 11 69,499,190 (GRCm38) missense probably damaging 1.00
R1186:Dnah2 UTSW 11 69,515,700 (GRCm38) missense probably damaging 0.99
R1453:Dnah2 UTSW 11 69,451,050 (GRCm38) missense probably damaging 0.99
R1498:Dnah2 UTSW 11 69,520,667 (GRCm38) splice site probably null
R1538:Dnah2 UTSW 11 69,477,202 (GRCm38) missense probably benign 0.17
R1574:Dnah2 UTSW 11 69,514,688 (GRCm38) missense probably benign 0.26
R1574:Dnah2 UTSW 11 69,514,688 (GRCm38) missense probably benign 0.26
R1590:Dnah2 UTSW 11 69,521,198 (GRCm38) missense probably benign 0.00
R1590:Dnah2 UTSW 11 69,422,754 (GRCm38) critical splice donor site probably null
R1655:Dnah2 UTSW 11 69,473,854 (GRCm38) missense probably damaging 1.00
R1695:Dnah2 UTSW 11 69,514,691 (GRCm38) missense possibly damaging 0.74
R1726:Dnah2 UTSW 11 69,497,889 (GRCm38) missense probably damaging 1.00
R1764:Dnah2 UTSW 11 69,423,543 (GRCm38) missense probably damaging 1.00
R1815:Dnah2 UTSW 11 69,475,574 (GRCm38) missense probably damaging 1.00
R1822:Dnah2 UTSW 11 69,514,804 (GRCm38) missense probably damaging 1.00
R1859:Dnah2 UTSW 11 69,437,886 (GRCm38) missense probably damaging 0.99
R1911:Dnah2 UTSW 11 69,515,752 (GRCm38) missense possibly damaging 0.64
R1913:Dnah2 UTSW 11 69,464,930 (GRCm38) missense probably damaging 1.00
R1981:Dnah2 UTSW 11 69,474,325 (GRCm38) missense probably damaging 1.00
R2010:Dnah2 UTSW 11 69,458,358 (GRCm38) critical splice donor site probably null
R2016:Dnah2 UTSW 11 69,437,070 (GRCm38) missense probably damaging 0.97
R2017:Dnah2 UTSW 11 69,437,070 (GRCm38) missense probably damaging 0.97
R2044:Dnah2 UTSW 11 69,524,240 (GRCm38) missense probably benign 0.14
R2077:Dnah2 UTSW 11 69,496,606 (GRCm38) missense possibly damaging 0.73
R2096:Dnah2 UTSW 11 69,455,916 (GRCm38) missense probably damaging 0.98
R2099:Dnah2 UTSW 11 69,493,237 (GRCm38) missense probably damaging 1.00
R2127:Dnah2 UTSW 11 69,458,185 (GRCm38) missense probably benign 0.02
R2128:Dnah2 UTSW 11 69,458,185 (GRCm38) missense probably benign 0.02
R2146:Dnah2 UTSW 11 69,515,761 (GRCm38) missense probably benign 0.14
R2147:Dnah2 UTSW 11 69,515,761 (GRCm38) missense probably benign 0.14
R2150:Dnah2 UTSW 11 69,515,761 (GRCm38) missense probably benign 0.14
R2404:Dnah2 UTSW 11 69,437,221 (GRCm38) missense probably damaging 0.99
R2510:Dnah2 UTSW 11 69,524,206 (GRCm38) nonsense probably null
R2517:Dnah2 UTSW 11 69,516,644 (GRCm38) missense probably damaging 1.00
R3014:Dnah2 UTSW 11 69,430,478 (GRCm38) missense probably benign
R3741:Dnah2 UTSW 11 69,448,469 (GRCm38) missense probably damaging 1.00
R3814:Dnah2 UTSW 11 69,492,650 (GRCm38) splice site probably null
R3872:Dnah2 UTSW 11 69,429,348 (GRCm38) missense probably damaging 1.00
R3873:Dnah2 UTSW 11 69,429,348 (GRCm38) missense probably damaging 1.00
R3874:Dnah2 UTSW 11 69,429,348 (GRCm38) missense probably damaging 1.00
R3875:Dnah2 UTSW 11 69,429,348 (GRCm38) missense probably damaging 1.00
R3881:Dnah2 UTSW 11 69,451,347 (GRCm38) missense possibly damaging 0.94
R3953:Dnah2 UTSW 11 69,454,103 (GRCm38) missense probably damaging 1.00
R3956:Dnah2 UTSW 11 69,484,021 (GRCm38) missense probably benign 0.00
R4501:Dnah2 UTSW 11 69,477,659 (GRCm38) missense probably benign
R4515:Dnah2 UTSW 11 69,465,631 (GRCm38) missense possibly damaging 0.61
R4612:Dnah2 UTSW 11 69,483,367 (GRCm38) missense possibly damaging 0.93
R4625:Dnah2 UTSW 11 69,463,661 (GRCm38) missense probably damaging 1.00
R4627:Dnah2 UTSW 11 69,465,376 (GRCm38) missense probably damaging 1.00
R4642:Dnah2 UTSW 11 69,496,559 (GRCm38) missense probably benign 0.00
R4683:Dnah2 UTSW 11 69,458,942 (GRCm38) missense probably damaging 1.00
R4698:Dnah2 UTSW 11 69,498,532 (GRCm38) missense probably damaging 1.00
R4710:Dnah2 UTSW 11 69,478,077 (GRCm38) missense probably damaging 1.00
R4712:Dnah2 UTSW 11 69,516,590 (GRCm38) missense possibly damaging 0.47
R4713:Dnah2 UTSW 11 69,476,688 (GRCm38) missense probably damaging 1.00
R4717:Dnah2 UTSW 11 69,429,357 (GRCm38) missense probably benign 0.00
R4740:Dnah2 UTSW 11 69,458,042 (GRCm38) missense probably damaging 0.96
R4780:Dnah2 UTSW 11 69,473,871 (GRCm38) missense probably damaging 0.97
R4825:Dnah2 UTSW 11 69,423,205 (GRCm38) missense probably damaging 1.00
R4864:Dnah2 UTSW 11 69,422,590 (GRCm38) missense probably damaging 0.98
R4868:Dnah2 UTSW 11 69,463,648 (GRCm38) missense probably damaging 1.00
R4879:Dnah2 UTSW 11 69,476,691 (GRCm38) missense probably damaging 1.00
R4908:Dnah2 UTSW 11 69,521,147 (GRCm38) missense probably benign 0.00
R4911:Dnah2 UTSW 11 69,499,104 (GRCm38) critical splice donor site probably null
R4954:Dnah2 UTSW 11 69,539,496 (GRCm38) missense possibly damaging 0.61
R4962:Dnah2 UTSW 11 69,455,973 (GRCm38) nonsense probably null
R5015:Dnah2 UTSW 11 69,497,882 (GRCm38) missense possibly damaging 0.89
R5049:Dnah2 UTSW 11 69,448,166 (GRCm38) missense probably damaging 1.00
R5055:Dnah2 UTSW 11 69,520,773 (GRCm38) missense possibly damaging 0.67
R5153:Dnah2 UTSW 11 69,520,933 (GRCm38) missense possibly damaging 0.84
R5155:Dnah2 UTSW 11 69,422,536 (GRCm38) missense probably damaging 1.00
R5186:Dnah2 UTSW 11 69,435,884 (GRCm38) missense probably damaging 1.00
R5187:Dnah2 UTSW 11 69,458,920 (GRCm38) missense probably benign 0.15
R5208:Dnah2 UTSW 11 69,458,920 (GRCm38) missense probably benign 0.15
R5252:Dnah2 UTSW 11 69,529,469 (GRCm38) missense probably damaging 0.98
R5296:Dnah2 UTSW 11 69,458,920 (GRCm38) missense probably benign 0.15
R5298:Dnah2 UTSW 11 69,458,920 (GRCm38) missense probably benign 0.15
R5299:Dnah2 UTSW 11 69,458,920 (GRCm38) missense probably benign 0.15
R5301:Dnah2 UTSW 11 69,458,920 (GRCm38) missense probably benign 0.15
R5324:Dnah2 UTSW 11 69,457,993 (GRCm38) missense probably benign 0.07
R5350:Dnah2 UTSW 11 69,516,036 (GRCm38) missense possibly damaging 0.48
R5377:Dnah2 UTSW 11 69,421,848 (GRCm38) missense probably damaging 1.00
R5393:Dnah2 UTSW 11 69,500,857 (GRCm38) missense probably benign
R5421:Dnah2 UTSW 11 69,435,636 (GRCm38) missense probably damaging 1.00
R5452:Dnah2 UTSW 11 69,524,383 (GRCm38) missense probably damaging 1.00
R5461:Dnah2 UTSW 11 69,473,351 (GRCm38) critical splice donor site probably null
R5474:Dnah2 UTSW 11 69,458,920 (GRCm38) missense probably benign 0.15
R5476:Dnah2 UTSW 11 69,458,920 (GRCm38) missense probably benign 0.15
R5477:Dnah2 UTSW 11 69,458,920 (GRCm38) missense probably benign 0.15
R5510:Dnah2 UTSW 11 69,458,920 (GRCm38) missense probably benign 0.15
R5527:Dnah2 UTSW 11 69,437,188 (GRCm38) nonsense probably null
R5566:Dnah2 UTSW 11 69,516,569 (GRCm38) nonsense probably null
R5587:Dnah2 UTSW 11 69,437,242 (GRCm38) missense probably damaging 1.00
R5628:Dnah2 UTSW 11 69,458,920 (GRCm38) missense probably benign 0.15
R5688:Dnah2 UTSW 11 69,458,920 (GRCm38) missense probably benign 0.15
R5690:Dnah2 UTSW 11 69,491,544 (GRCm38) missense probably benign 0.15
R5711:Dnah2 UTSW 11 69,435,390 (GRCm38) missense probably damaging 1.00
R5735:Dnah2 UTSW 11 69,430,817 (GRCm38) missense possibly damaging 0.93
R5826:Dnah2 UTSW 11 69,458,920 (GRCm38) missense probably benign 0.15
R5913:Dnah2 UTSW 11 69,448,430 (GRCm38) missense probably damaging 1.00
R5914:Dnah2 UTSW 11 69,458,920 (GRCm38) missense probably benign 0.15
R5960:Dnah2 UTSW 11 69,458,920 (GRCm38) missense probably benign 0.15
R5961:Dnah2 UTSW 11 69,458,920 (GRCm38) missense probably benign 0.15
R5961:Dnah2 UTSW 11 69,431,148 (GRCm38) missense probably damaging 1.00
R5977:Dnah2 UTSW 11 69,520,881 (GRCm38) missense possibly damaging 0.79
R6020:Dnah2 UTSW 11 69,500,839 (GRCm38) missense probably benign
R6036:Dnah2 UTSW 11 69,458,920 (GRCm38) missense probably benign 0.15
R6036:Dnah2 UTSW 11 69,458,920 (GRCm38) missense probably benign 0.15
R6050:Dnah2 UTSW 11 69,458,920 (GRCm38) missense probably benign 0.15
R6086:Dnah2 UTSW 11 69,516,008 (GRCm38) missense probably benign 0.30
R6115:Dnah2 UTSW 11 69,446,649 (GRCm38) missense probably damaging 1.00
R6123:Dnah2 UTSW 11 69,518,359 (GRCm38) missense probably benign 0.29
R6159:Dnah2 UTSW 11 69,458,920 (GRCm38) missense probably benign 0.15
R6159:Dnah2 UTSW 11 69,458,542 (GRCm38) missense probably damaging 1.00
R6163:Dnah2 UTSW 11 69,520,903 (GRCm38) nonsense probably null
R6171:Dnah2 UTSW 11 69,423,042 (GRCm38) missense probably damaging 1.00
R6263:Dnah2 UTSW 11 69,457,412 (GRCm38) missense probably damaging 1.00
R6298:Dnah2 UTSW 11 69,491,641 (GRCm38) missense probably benign 0.25
R6352:Dnah2 UTSW 11 69,448,227 (GRCm38) missense probably damaging 1.00
R6399:Dnah2 UTSW 11 69,458,518 (GRCm38) missense probably damaging 0.98
R6466:Dnah2 UTSW 11 69,539,415 (GRCm38) missense probably benign
R6478:Dnah2 UTSW 11 69,516,010 (GRCm38) missense probably benign 0.01
R6516:Dnah2 UTSW 11 69,465,386 (GRCm38) missense probably benign 0.34
R6538:Dnah2 UTSW 11 69,437,197 (GRCm38) missense possibly damaging 0.87
R6802:Dnah2 UTSW 11 69,423,690 (GRCm38) missense probably damaging 1.00
R6861:Dnah2 UTSW 11 69,455,963 (GRCm38) missense possibly damaging 0.64
R6869:Dnah2 UTSW 11 69,429,471 (GRCm38) missense probably damaging 1.00
R6894:Dnah2 UTSW 11 69,484,260 (GRCm38) missense probably benign 0.12
R6935:Dnah2 UTSW 11 69,421,741 (GRCm38) missense probably damaging 1.00
R7017:Dnah2 UTSW 11 69,491,547 (GRCm38) nonsense probably null
R7073:Dnah2 UTSW 11 69,430,492 (GRCm38) nonsense probably null
R7111:Dnah2 UTSW 11 69,446,753 (GRCm38) splice site probably null
R7125:Dnah2 UTSW 11 69,436,182 (GRCm38) missense probably damaging 0.99
R7190:Dnah2 UTSW 11 69,549,097 (GRCm38) splice site probably null
R7214:Dnah2 UTSW 11 69,431,109 (GRCm38) missense probably damaging 1.00
R7227:Dnah2 UTSW 11 69,421,396 (GRCm38) missense probably damaging 0.99
R7238:Dnah2 UTSW 11 69,459,146 (GRCm38) critical splice donor site probably null
R7256:Dnah2 UTSW 11 69,431,094 (GRCm38) missense probably damaging 1.00
R7267:Dnah2 UTSW 11 69,500,817 (GRCm38) missense probably damaging 1.00
R7420:Dnah2 UTSW 11 69,478,797 (GRCm38) missense possibly damaging 0.94
R7421:Dnah2 UTSW 11 69,492,805 (GRCm38) missense probably benign 0.25
R7437:Dnah2 UTSW 11 69,498,627 (GRCm38) missense probably damaging 1.00
R7461:Dnah2 UTSW 11 69,548,990 (GRCm38) critical splice donor site probably null
R7473:Dnah2 UTSW 11 69,491,658 (GRCm38) missense probably damaging 0.99
R7528:Dnah2 UTSW 11 69,500,796 (GRCm38) missense probably damaging 0.99
R7613:Dnah2 UTSW 11 69,548,990 (GRCm38) critical splice donor site probably null
R7615:Dnah2 UTSW 11 69,435,304 (GRCm38) missense probably damaging 0.99
R7626:Dnah2 UTSW 11 69,498,685 (GRCm38) missense probably damaging 0.99
R7745:Dnah2 UTSW 11 69,451,318 (GRCm38) nonsense probably null
R7764:Dnah2 UTSW 11 69,458,158 (GRCm38) missense probably benign 0.29
R7793:Dnah2 UTSW 11 69,495,214 (GRCm38) missense probably benign 0.00
R7819:Dnah2 UTSW 11 69,516,593 (GRCm38) missense probably benign 0.01
R7881:Dnah2 UTSW 11 69,431,238 (GRCm38) missense probably damaging 1.00
R7900:Dnah2 UTSW 11 69,518,428 (GRCm38) missense probably damaging 1.00
R7916:Dnah2 UTSW 11 69,421,148 (GRCm38) critical splice acceptor site probably null
R7921:Dnah2 UTSW 11 69,520,834 (GRCm38) missense probably benign
R7928:Dnah2 UTSW 11 69,430,835 (GRCm38) missense probably damaging 0.98
R7937:Dnah2 UTSW 11 69,517,685 (GRCm38) nonsense probably null
R7995:Dnah2 UTSW 11 69,520,737 (GRCm38) missense possibly damaging 0.77
R8202:Dnah2 UTSW 11 69,478,823 (GRCm38) missense probably benign 0.00
R8208:Dnah2 UTSW 11 69,520,852 (GRCm38) missense probably benign 0.05
R8215:Dnah2 UTSW 11 69,435,367 (GRCm38) missense probably damaging 1.00
R8279:Dnah2 UTSW 11 69,475,573 (GRCm38) missense probably damaging 1.00
R8338:Dnah2 UTSW 11 69,487,296 (GRCm38) missense probably damaging 1.00
R8348:Dnah2 UTSW 11 69,429,447 (GRCm38) missense possibly damaging 0.95
R8405:Dnah2 UTSW 11 69,458,463 (GRCm38) missense probably damaging 1.00
R8407:Dnah2 UTSW 11 69,459,278 (GRCm38) missense probably benign 0.00
R8493:Dnah2 UTSW 11 69,452,978 (GRCm38) missense probably damaging 1.00
R8673:Dnah2 UTSW 11 69,514,697 (GRCm38) missense probably benign 0.23
R8725:Dnah2 UTSW 11 69,524,179 (GRCm38) missense probably damaging 1.00
R8727:Dnah2 UTSW 11 69,524,179 (GRCm38) missense probably damaging 1.00
R8730:Dnah2 UTSW 11 69,493,261 (GRCm38) missense possibly damaging 0.73
R8804:Dnah2 UTSW 11 69,465,685 (GRCm38) missense probably benign 0.01
R8876:Dnah2 UTSW 11 69,491,522 (GRCm38) missense probably damaging 1.00
R8894:Dnah2 UTSW 11 69,492,222 (GRCm38) missense probably benign 0.01
R8938:Dnah2 UTSW 11 69,437,928 (GRCm38) missense probably damaging 0.99
R9044:Dnah2 UTSW 11 69,529,421 (GRCm38) missense probably benign
R9085:Dnah2 UTSW 11 69,429,398 (GRCm38) missense possibly damaging 0.69
R9110:Dnah2 UTSW 11 69,544,382 (GRCm38) missense probably benign
R9156:Dnah2 UTSW 11 69,422,861 (GRCm38) missense
R9251:Dnah2 UTSW 11 69,515,793 (GRCm38) missense probably damaging 1.00
R9258:Dnah2 UTSW 11 69,477,253 (GRCm38) missense probably damaging 1.00
R9279:Dnah2 UTSW 11 69,518,278 (GRCm38) missense probably benign 0.01
R9318:Dnah2 UTSW 11 69,484,329 (GRCm38) missense probably benign 0.07
R9321:Dnah2 UTSW 11 69,448,113 (GRCm38) critical splice donor site probably null
R9350:Dnah2 UTSW 11 69,493,247 (GRCm38) missense probably benign 0.10
R9358:Dnah2 UTSW 11 69,515,766 (GRCm38) missense probably damaging 0.99
R9417:Dnah2 UTSW 11 69,436,164 (GRCm38) missense probably damaging 1.00
R9420:Dnah2 UTSW 11 69,478,116 (GRCm38) missense probably benign 0.09
R9438:Dnah2 UTSW 11 69,473,394 (GRCm38) missense probably damaging 1.00
R9469:Dnah2 UTSW 11 69,431,070 (GRCm38) missense probably damaging 1.00
R9487:Dnah2 UTSW 11 69,515,791 (GRCm38) missense possibly damaging 0.47
R9495:Dnah2 UTSW 11 69,454,382 (GRCm38) missense possibly damaging 0.89
R9579:Dnah2 UTSW 11 69,477,215 (GRCm38) missense probably damaging 1.00
R9608:Dnah2 UTSW 11 69,454,062 (GRCm38) missense probably null 1.00
R9651:Dnah2 UTSW 11 69,450,998 (GRCm38) critical splice donor site probably null
R9662:Dnah2 UTSW 11 69,452,937 (GRCm38) missense probably benign
RF004:Dnah2 UTSW 11 69,437,187 (GRCm38) missense probably benign 0.24
U24488:Dnah2 UTSW 11 69,483,822 (GRCm38) missense probably damaging 0.99
X0021:Dnah2 UTSW 11 69,448,562 (GRCm38) missense possibly damaging 0.81
Z1088:Dnah2 UTSW 11 69,430,793 (GRCm38) missense probably damaging 1.00
Z1176:Dnah2 UTSW 11 69,421,821 (GRCm38) missense possibly damaging 0.46
Z1176:Dnah2 UTSW 11 69,516,523 (GRCm38) missense probably damaging 1.00
Z1176:Dnah2 UTSW 11 69,516,481 (GRCm38) missense probably damaging 1.00
Z1176:Dnah2 UTSW 11 69,498,667 (GRCm38) missense probably benign 0.12
Z1176:Dnah2 UTSW 11 69,487,054 (GRCm38) missense possibly damaging 0.46
Z1176:Dnah2 UTSW 11 69,451,120 (GRCm38) missense probably benign
Z1177:Dnah2 UTSW 11 69,544,557 (GRCm38) critical splice acceptor site probably null
Z1177:Dnah2 UTSW 11 69,463,453 (GRCm38) missense possibly damaging 0.63
Predicted Primers PCR Primer
(F):5'- TACCCAGTGATCTCAGCTACCC -3'
(R):5'- ACAGGCTGGCCTTTCAAGAG -3'

Sequencing Primer
(F):5'- AGTTTAAAGCCAGCCTGGTC -3'
(R):5'- GGATCAGATCGCACAGAT -3'
Posted On 2019-05-15