Incidental Mutation 'PIT4812001:Atp13a3'
List |< first << previous [record 5 of 62] next >> last >|
ID556941
Institutional Source Beutler Lab
Gene Symbol Atp13a3
Ensembl Gene ENSMUSG00000022533
Gene NameATPase type 13A3
SynonymsLOC224088, LOC385637, LOC224087
Accession Numbers
Is this an essential gene? Possibly non essential (E-score: 0.402) question?
Stock #PIT4812001 (G1)
Quality Score150.008
Status Not validated
Chromosome16
Chromosomal Location30312423-30405975 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 30362578 bp
ZygosityHeterozygous
Amino Acid Change Threonine to Alanine at position 75 (T75A)
Ref Sequence ENSEMBL: ENSMUSP00000128224 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000061350] [ENSMUST00000100013] [ENSMUST00000229616]
Predicted Effect probably damaging
Transcript: ENSMUST00000061350
AA Change: T75A

PolyPhen 2 Score 0.981 (Sensitivity: 0.75; Specificity: 0.96)
SMART Domains Protein: ENSMUSP00000051645
Gene: ENSMUSG00000022533
AA Change: T75A

DomainStartEndE-ValueType
Pfam:P5-ATPase 13 139 4.9e-30 PFAM
Cation_ATPase_N 154 227 7.24e0 SMART
Pfam:E1-E2_ATPase 232 483 5.1e-36 PFAM
Pfam:HAD 491 888 7.5e-28 PFAM
Pfam:Hydrolase_like2 607 661 6.8e-8 PFAM
Pfam:Hydrolase 612 790 6.5e-11 PFAM
transmembrane domain 931 953 N/A INTRINSIC
transmembrane domain 963 985 N/A INTRINSIC
transmembrane domain 997 1019 N/A INTRINSIC
transmembrane domain 1068 1085 N/A INTRINSIC
transmembrane domain 1098 1120 N/A INTRINSIC
transmembrane domain 1135 1153 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000100013
AA Change: T75A

PolyPhen 2 Score 0.977 (Sensitivity: 0.76; Specificity: 0.96)
SMART Domains Protein: ENSMUSP00000128224
Gene: ENSMUSG00000022533
AA Change: T75A

DomainStartEndE-ValueType
Pfam:P5-ATPase 13 146 2.9e-38 PFAM
Cation_ATPase_N 154 227 7.24e0 SMART
Pfam:E1-E2_ATPase 232 483 7.3e-41 PFAM
Pfam:Hydrolase 488 784 1.3e-12 PFAM
Pfam:HAD 491 888 1.3e-31 PFAM
Pfam:Cation_ATPase 612 660 4.5e-7 PFAM
transmembrane domain 931 953 N/A INTRINSIC
transmembrane domain 963 985 N/A INTRINSIC
transmembrane domain 997 1019 N/A INTRINSIC
transmembrane domain 1068 1085 N/A INTRINSIC
transmembrane domain 1098 1120 N/A INTRINSIC
transmembrane domain 1135 1157 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000229616
Coding Region Coverage
  • 1x: 93.8%
  • 3x: 91.0%
  • 10x: 85.3%
  • 20x: 73.0%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] ATP13A3 is a member of the P-type ATPase family of proteins that transport a variety of cations across membranes. Other P-type ATPases include ATP7B (MIM 606882) and ATP7A (MIM 300011).[supplied by OMIM, Aug 2008]
Allele List at MGI
Other mutations in this stock
Total: 61 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4921524L21Rik T C 18: 6,630,053 S252P possibly damaging Het
4933409G03Rik G A 2: 68,588,948 V14I probably benign Het
Adgrf5 T G 17: 43,450,369 V985G probably damaging Het
Ankrd44 A T 1: 54,723,038 Y542* probably null Het
Atr T C 9: 95,910,649 F1675L probably benign Het
Atrnl1 A G 19: 57,731,623 I1082V probably benign Het
C87977 A G 4: 144,209,516 I56T probably benign Het
Clip1 T A 5: 123,630,675 R620S probably benign Het
Cped1 T C 6: 22,122,294 F391S probably benign Het
Cracr2a T C 6: 127,625,870 L230P probably damaging Het
Dctn1 T A 6: 83,199,762 V1266E possibly damaging Het
Dlg1 T A 16: 31,846,885 F687I probably benign Het
Dnah8 C A 17: 30,708,445 D1358E probably benign Het
Dnajc11 A G 4: 151,952,889 R84G probably benign Het
Dnajc14 C A 10: 128,806,683 T158N probably damaging Het
Dscc1 A G 15: 55,082,261 L346P probably damaging Het
Efcab3 A G 11: 105,099,979 I71V probably null Het
Erbb3 T A 10: 128,574,379 Q670L possibly damaging Het
Ercc4 G A 16: 13,144,447 E652K probably benign Het
Ercc6l2 T A 13: 63,858,257 V591D possibly damaging Het
Fam126b T G 1: 58,548,703 D117A possibly damaging Het
Fam3c C T 6: 22,321,370 G134E probably damaging Het
Frmd5 A G 2: 121,586,446 V70A probably benign Het
Gjc1 A T 11: 102,800,981 Y65* probably null Het
Gm3033 A C 14: 3,848,891 L137F Het
Gria4 C A 9: 4,427,128 A771S probably damaging Het
Hc A G 2: 35,029,452 L674P probably benign Het
Hjurp CTCTGGGAGGGCTTGCTCCGGGGGCAGTGTGTCCTGTTCTTGTGCAGCCCCT C 1: 88,266,277 probably benign Het
Inpp5f A T 7: 128,692,308 Y696F probably benign Het
Itga11 C A 9: 62,732,193 Q157K probably damaging Het
Itgb5 G T 16: 33,919,987 C489F probably damaging Het
Klhl38 C T 15: 58,322,542 G264S probably benign Het
Krt78 C T 15: 101,948,069 V436M probably damaging Het
Mia2 A T 12: 59,101,579 D75V possibly damaging Het
Mphosph6 T A 8: 117,799,149 Q20L probably damaging Het
Ogfr C T 2: 180,595,511 P630S possibly damaging Het
Olfr1206 G A 2: 88,864,970 V122M probably benign Het
Olfr1431 T G 19: 12,210,253 I229S probably damaging Het
Olfr15 A T 16: 3,839,530 K186* probably null Het
Pbx3 T C 2: 34,224,619 E101G probably damaging Het
Pcca T A 14: 122,790,382 N587K probably benign Het
Pdia3 G T 2: 121,433,530 A287S probably damaging Het
Pfas T A 11: 68,990,036 D209V Het
Pter A T 2: 12,980,368 I170F probably damaging Het
Ptprq A T 10: 107,666,567 V830E probably damaging Het
Rab11fip5 T C 6: 85,341,558 D783G probably benign Het
Rbm19 T C 5: 120,128,250 V446A possibly damaging Het
Selp A G 1: 164,132,263 N363D probably benign Het
Six2 C A 17: 85,685,301 S258I possibly damaging Het
Smc1b A G 15: 85,069,651 V1139A possibly damaging Het
Sp1 A G 15: 102,408,408 T121A possibly damaging Het
Sucla2 A T 14: 73,579,449 I210L possibly damaging Het
Trank1 T C 9: 111,347,912 L339P probably damaging Het
Ttll5 T A 12: 85,926,861 D794E probably benign Het
Usp32 C T 11: 85,010,074 V1107I probably damaging Het
Vmn1r195 T C 13: 22,278,863 Y168H probably benign Het
Vmn1r223 A G 13: 23,249,890 N218S probably damaging Het
Vmn2r25 T A 6: 123,823,488 S632C probably damaging Het
Vwa3a A T 7: 120,776,133 K390I probably damaging Het
Zfp442 A T 2: 150,409,741 C80* probably null Het
Zic1 A T 9: 91,364,341 I226N probably damaging Het
Other mutations in Atp13a3
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00234:Atp13a3 APN 16 30351279 missense probably damaging 0.99
IGL00490:Atp13a3 APN 16 30352354 missense probably benign 0.31
IGL01844:Atp13a3 APN 16 30361963 missense probably benign 0.17
IGL01994:Atp13a3 APN 16 30337518 missense possibly damaging 0.90
IGL02057:Atp13a3 APN 16 30332364 missense probably benign
IGL02083:Atp13a3 APN 16 30347706 missense possibly damaging 0.89
IGL02348:Atp13a3 APN 16 30351228 critical splice donor site probably null
IGL02352:Atp13a3 APN 16 30351084 missense probably damaging 1.00
IGL02359:Atp13a3 APN 16 30351084 missense probably damaging 1.00
IGL02643:Atp13a3 APN 16 30333796 missense probably null
IGL02687:Atp13a3 APN 16 30337551 missense probably damaging 1.00
IGL02951:Atp13a3 APN 16 30338621 splice site probably null
IGL03190:Atp13a3 APN 16 30322948 missense probably benign 0.00
H8562:Atp13a3 UTSW 16 30359725 nonsense probably null
H8786:Atp13a3 UTSW 16 30359725 nonsense probably null
R0725:Atp13a3 UTSW 16 30351387 missense probably damaging 1.00
R1208:Atp13a3 UTSW 16 30354247 missense probably benign 0.21
R1208:Atp13a3 UTSW 16 30354247 missense probably benign 0.21
R1244:Atp13a3 UTSW 16 30361836 missense probably benign 0.00
R1326:Atp13a3 UTSW 16 30352310 missense probably damaging 1.00
R1613:Atp13a3 UTSW 16 30332300 missense probably damaging 1.00
R1672:Atp13a3 UTSW 16 30332274 missense possibly damaging 0.96
R1709:Atp13a3 UTSW 16 30315841 missense probably benign 0.37
R1733:Atp13a3 UTSW 16 30357266 missense probably benign 0.35
R2086:Atp13a3 UTSW 16 30352298 missense possibly damaging 0.89
R2128:Atp13a3 UTSW 16 30354276 missense probably damaging 0.97
R2421:Atp13a3 UTSW 16 30349825 missense probably benign 0.29
R3427:Atp13a3 UTSW 16 30344593 missense probably benign 0.05
R3783:Atp13a3 UTSW 16 30354249 missense probably damaging 1.00
R4058:Atp13a3 UTSW 16 30354246 missense possibly damaging 0.94
R4059:Atp13a3 UTSW 16 30354246 missense possibly damaging 0.94
R4798:Atp13a3 UTSW 16 30341240 missense probably damaging 1.00
R5045:Atp13a3 UTSW 16 30339876 missense probably benign 0.24
R5216:Atp13a3 UTSW 16 30340284 missense probably damaging 1.00
R5704:Atp13a3 UTSW 16 30321879 missense probably benign 0.18
R5876:Atp13a3 UTSW 16 30362734 missense probably benign 0.13
R5947:Atp13a3 UTSW 16 30362700 missense probably benign 0.01
R6291:Atp13a3 UTSW 16 30336243 missense probably damaging 0.99
R6324:Atp13a3 UTSW 16 30332285 missense possibly damaging 0.72
R6328:Atp13a3 UTSW 16 30336235 missense probably damaging 0.99
R6372:Atp13a3 UTSW 16 30343455 missense probably damaging 0.99
R6446:Atp13a3 UTSW 16 30361869 missense probably benign 0.00
R7016:Atp13a3 UTSW 16 30338490 missense possibly damaging 0.54
R7086:Atp13a3 UTSW 16 30351063 missense possibly damaging 0.87
R7241:Atp13a3 UTSW 16 30352277 missense possibly damaging 0.93
R7589:Atp13a3 UTSW 16 30344615 missense probably benign 0.04
R8098:Atp13a3 UTSW 16 30354297 missense possibly damaging 0.85
R8191:Atp13a3 UTSW 16 30349780 missense probably damaging 1.00
R8299:Atp13a3 UTSW 16 30333801 missense probably damaging 1.00
R8785:Atp13a3 UTSW 16 30350982 missense probably benign 0.04
Predicted Primers PCR Primer
(F):5'- CTGTGGGTCATGAAGAGCTATAAG -3'
(R):5'- TTCTGTGCAGGAGATACATGGC -3'

Sequencing Primer
(F):5'- GCTATAAGAGGACAGTCTCATCAGC -3'
(R):5'- GCTATAACTTATGCCGCTGGAAGC -3'
Posted On2019-06-07