Incidental Mutation 'R7155:Ddx10'
ID 557224
Institutional Source Beutler Lab
Gene Symbol Ddx10
Ensembl Gene ENSMUSG00000053289
Gene Name DEAD (Asp-Glu-Ala-Asp) box polypeptide 10
Synonyms 4632415A01Rik
MMRRC Submission
Accession Numbers
Is this an essential gene? Probably essential (E-score: 0.963) question?
Stock # R7155 (G1)
Quality Score 225.009
Status Not validated
Chromosome 9
Chromosomal Location 53098635-53248053 bp(-) (GRCm38)
Type of Mutation missense
DNA Base Change (assembly) G to A at 53117288 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change Alanine to Valine at position 772 (A772V)
Ref Sequence ENSEMBL: ENSMUSP00000065198 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000065630]
AlphaFold Q80Y44
Predicted Effect probably benign
Transcript: ENSMUST00000065630
AA Change: A772V

PolyPhen 2 Score 0.001 (Sensitivity: 0.99; Specificity: 0.15)
SMART Domains Protein: ENSMUSP00000065198
Gene: ENSMUSG00000053289
AA Change: A772V

DomainStartEndE-ValueType
low complexity region 24 43 N/A INTRINSIC
DEXDc 88 291 1.74e-53 SMART
HELICc 327 410 8.48e-25 SMART
DUF4217 450 513 6.06e-25 SMART
low complexity region 577 594 N/A INTRINSIC
low complexity region 627 637 N/A INTRINSIC
low complexity region 658 680 N/A INTRINSIC
low complexity region 748 773 N/A INTRINSIC
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.7%
  • 20x: 98.8%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] DEAD box proteins, characterized by the conserved motif Asp-Glu-Ala-Asp (DEAD), are putative RNA helicases. They are implicated in a number of cellular processes involving alteration of RNA secondary structure such as translation initiation, nuclear and mitochondrial splicing, and ribosome and spliceosome assembly. Based on their distribution patterns, some members of this family are believed to be involved in embryogenesis, spermatogenesis, and cellular growth and division. This gene encodes a DEAD box protein, and it may be involved in ribosome assembly. Fusion of this gene and the nucleoporin gene, NUP98, by inversion 11 (p15q22) chromosome translocation is found in the patients with de novo or therapy-related myeloid malignancies. [provided by RefSeq, Jul 2008]
PHENOTYPE: Mice homozygous for a spontaneous allele exhibit craniofacial defects, including decreased cranium length, cleft palate, and short snout, and show reduced body size, body weight, lean body mass, and bone mineral content. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 85 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4921509C19Rik A G 2: 151,473,569 L63P possibly damaging Het
Abca13 A T 11: 9,529,010 Y4286F probably benign Het
Aldh5a1 A C 13: 24,911,589 V515G possibly damaging Het
Ankrd42 T C 7: 92,591,933 E406G possibly damaging Het
Arfgef2 T A 2: 166,865,813 M1043K probably benign Het
Arhgef11 T A 3: 87,709,572 Y383* probably null Het
Aste1 C T 9: 105,405,136 P614L probably damaging Het
B3galt5 T A 16: 96,315,805 S213T probably damaging Het
Bak1 A G 17: 27,022,460 L108P possibly damaging Het
Bcl6 G A 16: 23,966,226 R675* probably null Het
Bdp1 T G 13: 100,061,151 T909P possibly damaging Het
Cacna1i A G 15: 80,395,238 H2060R probably benign Het
Cdhr3 G T 12: 33,061,773 P246Q probably damaging Het
Colgalt1 T C 8: 71,623,710 S602P probably damaging Het
Csde1 T C 3: 103,039,953 S74P probably damaging Het
Cyp51 A T 5: 4,087,846 C366S possibly damaging Het
Dcaf7 A G 11: 106,037,190 N23D probably damaging Het
Ddx4 A G 13: 112,613,785 F404S probably benign Het
Dirc2 G T 16: 35,735,577 T171K probably benign Het
Dlg4 T A 11: 70,017,216 M1K probably null Het
Dnajc6 T C 4: 101,612,945 V293A probably damaging Het
Etl4 G T 2: 20,806,931 R1643L probably damaging Het
F13b G A 1: 139,508,157 E234K probably damaging Het
Fam171a1 T C 2: 3,225,729 I633T probably benign Het
Frem3 A G 8: 80,616,039 I1654V probably benign Het
Galr2 A G 11: 116,283,582 E346G possibly damaging Het
Gck G A 11: 5,949,705 probably benign Het
Gen1 G T 12: 11,241,832 T717K probably benign Het
Gm13083 A T 4: 143,616,165 I281F probably benign Het
Gpatch8 TTCCTCCTCCTCCTCTTCCTCCTCCTC TTCCTCCTCCTCCTCCTCTTCCTCCTCCTC 11: 102,480,188 probably benign Het
Hat1 A G 2: 71,421,251 T215A possibly damaging Het
Hmbox1 A T 14: 64,897,037 M38K probably damaging Het
Ifi47 A G 11: 49,096,542 K379E probably benign Het
Ift81 T C 5: 122,568,999 Y460C probably damaging Het
Jarid2 T A 13: 44,902,462 S381R probably damaging Het
Kmt2b A T 7: 30,579,963 V1458E probably damaging Het
Kpna4 G T 3: 69,089,933 P336Q probably damaging Het
Krt84 T C 15: 101,532,254 R168G probably damaging Het
Lhx8 T A 3: 154,324,584 Y137F possibly damaging Het
Lin7b T C 7: 45,370,227 E19G probably damaging Het
Lrmda A T 14: 22,584,540 R131S probably damaging Het
Lrrc75b C T 10: 75,553,678 A280T possibly damaging Het
Megf11 G A 9: 64,647,951 R268K probably null Het
Mgat4e G T 1: 134,541,959 Q116K probably damaging Het
Mlkl A G 8: 111,319,403 L325P probably damaging Het
Mup2 A G 4: 60,137,641 L134P probably damaging Het
Myo19 A G 11: 84,900,586 E489G probably damaging Het
Ncbp3 C A 11: 73,048,009 P37Q probably damaging Het
Nf2 A G 11: 4,799,964 V236A probably damaging Het
Nlrp1a A T 11: 71,124,079 M115K possibly damaging Het
Nsf T A 11: 103,828,530 K649* probably null Het
Olfml2b A T 1: 170,666,785 I313L probably benign Het
Olfr316 T A 11: 58,758,283 I206N probably damaging Het
Olfr654 T A 7: 104,588,557 V251D possibly damaging Het
Papln T A 12: 83,776,521 L444Q probably damaging Het
Phc3 T C 3: 30,914,197 I897V probably benign Het
Plcg1 T C 2: 160,754,380 L632P probably damaging Het
Prkg1 T C 19: 31,302,301 T178A probably damaging Het
Ptges T A 2: 30,892,804 T79S probably benign Het
Rab26 T C 17: 24,532,289 T81A probably damaging Het
Rai14 T A 15: 10,595,003 I145L possibly damaging Het
Rasgrf1 A G 9: 90,002,361 T960A possibly damaging Het
Rfx1 A T 8: 84,094,826 I755F probably damaging Het
Rims1 T G 1: 22,432,923 L670F probably damaging Het
Rtkn G A 6: 83,149,711 C297Y probably damaging Het
Sec23a A T 12: 58,989,443 N378K probably benign Het
Slc17a2 A G 13: 23,822,407 E472G probably benign Het
Slc1a2 T C 2: 102,766,995 M449T probably damaging Het
Slc22a3 G A 17: 12,433,631 L369F possibly damaging Het
Smad6 G T 9: 64,021,787 D82E unknown Het
Smgc A T 15: 91,852,608 I463F possibly damaging Het
Strada C A 11: 106,171,039 G166C probably damaging Het
Tcaf3 A G 6: 42,593,891 V309A probably benign Het
Tet2 C T 3: 133,469,591 E1332K possibly damaging Het
Tfcp2l1 A G 1: 118,668,632 N366D probably damaging Het
Tll2 G A 19: 41,117,284 P369L possibly damaging Het
Tox4 T C 14: 52,292,097 V505A probably benign Het
Trbv4 A G 6: 41,059,853 D104G probably damaging Het
Ugdh T C 5: 65,417,037 E416G probably damaging Het
Usp47 T A 7: 112,087,013 C613S probably damaging Het
Vmn1r11 T A 6: 57,138,162 N270K probably benign Het
Wsb2 T A 5: 117,371,095 L147Q probably damaging Het
Xrn1 G A 9: 95,979,145 A453T possibly damaging Het
Zan A G 5: 137,461,844 S1262P unknown Het
Zswim4 A G 8: 84,219,927 L700P probably damaging Het
Other mutations in Ddx10
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00763:Ddx10 APN 9 53160026 splice site probably benign
IGL01111:Ddx10 APN 9 53159948 missense possibly damaging 0.73
IGL01773:Ddx10 APN 9 53204130 missense possibly damaging 0.94
IGL01837:Ddx10 APN 9 53229198 missense probably benign 0.16
IGL02036:Ddx10 APN 9 53204183 missense probably benign 0.00
IGL02236:Ddx10 APN 9 53235382 missense probably damaging 1.00
IGL02939:Ddx10 APN 9 53204279 missense possibly damaging 0.63
IGL03294:Ddx10 APN 9 53117152 critical splice donor site probably null
R0279:Ddx10 UTSW 9 53235304 missense probably damaging 1.00
R1439:Ddx10 UTSW 9 53240487 missense probably damaging 1.00
R1501:Ddx10 UTSW 9 53233997 missense possibly damaging 0.85
R1529:Ddx10 UTSW 9 53117199 nonsense probably null
R1548:Ddx10 UTSW 9 53149561 critical splice acceptor site probably null
R1717:Ddx10 UTSW 9 53159953 missense probably benign 0.25
R1720:Ddx10 UTSW 9 53238071 missense probably damaging 1.00
R1781:Ddx10 UTSW 9 53207545 missense probably damaging 1.00
R2005:Ddx10 UTSW 9 53240475 critical splice donor site probably null
R2007:Ddx10 UTSW 9 53213278 missense probably benign 0.06
R2073:Ddx10 UTSW 9 53240505 missense probably benign 0.28
R2075:Ddx10 UTSW 9 53240505 missense probably benign 0.28
R2133:Ddx10 UTSW 9 53149512 missense probably benign 0.13
R4660:Ddx10 UTSW 9 53236398 critical splice donor site probably null
R4668:Ddx10 UTSW 9 53099213 missense possibly damaging 0.55
R4706:Ddx10 UTSW 9 53233931 missense probably damaging 1.00
R4814:Ddx10 UTSW 9 53204105 missense possibly damaging 0.54
R5394:Ddx10 UTSW 9 53233857 nonsense probably null
R5655:Ddx10 UTSW 9 53209687 critical splice donor site probably null
R5874:Ddx10 UTSW 9 53229198 missense possibly damaging 0.95
R6341:Ddx10 UTSW 9 53204251 missense probably benign 0.00
R6534:Ddx10 UTSW 9 53223688 missense probably damaging 1.00
R6801:Ddx10 UTSW 9 53247907 nonsense probably null
R6994:Ddx10 UTSW 9 53204111 missense probably damaging 0.99
R7380:Ddx10 UTSW 9 53240486 missense probably damaging 1.00
R7753:Ddx10 UTSW 9 53225604 missense probably damaging 1.00
R8101:Ddx10 UTSW 9 53225520 missense probably damaging 0.98
R8782:Ddx10 UTSW 9 53235288 missense probably damaging 0.99
R8962:Ddx10 UTSW 9 53238077 missense probably damaging 1.00
R8998:Ddx10 UTSW 9 53229234 missense possibly damaging 0.64
R8999:Ddx10 UTSW 9 53229234 missense possibly damaging 0.64
R9283:Ddx10 UTSW 9 53235356 missense probably benign 0.01
X0019:Ddx10 UTSW 9 53233996 missense probably damaging 1.00
X0063:Ddx10 UTSW 9 53225573 missense probably damaging 1.00
Z1177:Ddx10 UTSW 9 53204511 missense probably damaging 0.98
Predicted Primers PCR Primer
(F):5'- CAAGTTGGAGTTTATAGGGCATTAG -3'
(R):5'- AAATTCTAAGTCTTGTTTCCAGGCC -3'

Sequencing Primer
(F):5'- CTGGACTCATTAAAATAGAAAGGGTC -3'
(R):5'- AGTCTTGTTTCCAGGCCTTTATAATG -3'
Posted On 2019-06-26