Incidental Mutation 'R7224:Anxa6'
ID 562047
Institutional Source Beutler Lab
Gene Symbol Anxa6
Ensembl Gene ENSMUSG00000018340
Gene Name annexin A6
Synonyms AnxVI, Anx6, Cabm, Camb, Annexin VI
MMRRC Submission
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.111) question?
Stock # R7224 (G1)
Quality Score 225.009
Status Validated
Chromosome 11
Chromosomal Location 54979108-55033445 bp(-) (GRCm38)
Type of Mutation missense
DNA Base Change (assembly) A to G at 54986167 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change Phenylalanine to Leucine at position 547 (F547L)
Ref Sequence ENSEMBL: ENSMUSP00000104511 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000102727] [ENSMUST00000108883]
AlphaFold P14824
Predicted Effect possibly damaging
Transcript: ENSMUST00000102727
AA Change: F541L

PolyPhen 2 Score 0.955 (Sensitivity: 0.79; Specificity: 0.95)
SMART Domains Protein: ENSMUSP00000099788
Gene: ENSMUSG00000018340
AA Change: F541L

DomainStartEndE-ValueType
ANX 37 89 4.03e-19 SMART
ANX 109 161 2.09e-26 SMART
ANX 193 245 1.55e-20 SMART
ANX 268 320 2.23e-21 SMART
ANX 380 432 9.47e-25 SMART
ANX 452 504 1.12e-26 SMART
ANX 535 587 7.77e-12 SMART
ANX 610 662 4.73e-25 SMART
Predicted Effect probably damaging
Transcript: ENSMUST00000108883
AA Change: F547L

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000104511
Gene: ENSMUSG00000018340
AA Change: F547L

DomainStartEndE-ValueType
ANX 37 89 4.03e-19 SMART
ANX 109 161 2.09e-26 SMART
ANX 193 245 1.55e-20 SMART
ANX 268 320 2.23e-21 SMART
ANX 380 432 9.47e-25 SMART
ANX 452 504 1.12e-26 SMART
low complexity region 517 528 N/A INTRINSIC
ANX 541 593 7.77e-12 SMART
ANX 616 668 4.73e-25 SMART
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.6%
  • 20x: 98.4%
Validation Efficiency 99% (79/80)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] Annexin VI belongs to a family of calcium-dependent membrane and phospholipid binding proteins. Several members of the annexin family have been implicated in membrane-related events along exocytotic and endocytotic pathways. The annexin VI gene is approximately 60 kbp long and contains 26 exons. It encodes a protein of about 68 kDa that consists of eight 68-amino acid repeats separated by linking sequences of variable lengths. It is highly similar to human annexins I and II sequences, each of which contain four such repeats. Annexin VI has been implicated in mediating the endosome aggregation and vesicle fusion in secreting epithelia during exocytosis. Alternatively spliced transcript variants have been described. [provided by RefSeq, Aug 2010]
PHENOTYPE: Mice homozygous for a knock-out allele have normal immunological development but exhibit altered cardiomyocyte mechanics and intracellular calcium signaling. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 79 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4930432K21Rik A G 8: 84,172,213 T577A probably benign Het
Aadac C T 3: 60,035,854 T60M probably benign Het
Actn4 C T 7: 28,962,084 A34T probably benign Het
Acvrl1 A G 15: 101,143,364 M466V probably benign Het
Adamts7 T C 9: 90,185,815 Y453H probably damaging Het
Amfr G A 8: 93,984,856 P351S probably damaging Het
Ankrd26 G A 6: 118,539,727 T492M probably benign Het
Ap5m1 T G 14: 49,080,927 Y394D unknown Het
Atic G A 1: 71,570,855 V342I probably benign Het
Atl1 C A 12: 69,955,353 T362N probably benign Het
Atp10a A T 7: 58,797,471 M654L probably benign Het
B3gnt5 A T 16: 19,769,753 M241L probably benign Het
Bbs7 A G 3: 36,605,728 V186A possibly damaging Het
C8b T C 4: 104,780,598 L89P probably damaging Het
Capn7 G T 14: 31,370,721 E742* probably null Het
Ccdc162 G A 10: 41,561,191 R1741C probably damaging Het
Chsy3 T A 18: 59,408,975 L395H probably damaging Het
Cnot9 A G 1: 74,517,229 T62A probably benign Het
Cyfip1 AGTGT AGT 7: 55,928,189 probably null Het
Cyp2d12 T A 15: 82,557,648 probably null Het
Dnah7a A G 1: 53,397,261 V3974A probably benign Het
Dync1h1 G A 12: 110,617,762 G533D possibly damaging Het
Elfn1 A G 5: 139,972,473 S411G probably benign Het
Enpp3 T C 10: 24,776,884 D725G possibly damaging Het
Epp13 T G 7: 6,268,802 M77R probably benign Het
Fmnl1 T C 11: 103,182,769 probably null Het
Fndc8 T C 11: 82,892,325 M44T probably benign Het
Gcgr A T 11: 120,534,712 probably benign Het
Ggt1 T A 10: 75,574,276 V14D possibly damaging Het
Gigyf2 A G 1: 87,403,725 I198M unknown Het
Gm28710 T C 5: 16,836,594 V615A possibly damaging Het
Gm40460 GCAGCAGCTGGACTGGCAGCAGCAGGGCTTACAGCAGCTGGACTGGCAGCAGCAGGGCTTACAGCAGCTGGACTGGCAGCAGCAGGGCTTACAGCAGCTGGACTGGCAGCAG GCAGCAGCTGGACTGGCAGCAGCAGGGCTTACAGCAGCTGGACTGGCAGCAGCAGGGCTTACAGCAGCTGGACTGGCAGCAG 7: 142,240,434 probably benign Het
Gm6034 T A 17: 36,056,439 S59T unknown Het
Gm6408 G A 5: 146,484,370 V270I probably benign Het
Gm853 C G 4: 130,219,199 A135P probably damaging Het
Gpr20 A T 15: 73,696,132 I136N probably damaging Het
Ide T C 19: 37,290,761 E565G Het
Igsf9 T C 1: 172,494,782 S515P probably damaging Het
Kbtbd12 G A 6: 88,613,983 R416* probably null Het
Kcnd3 A T 3: 105,669,084 I615F probably damaging Het
Kcnk7 A T 19: 5,706,777 M265L probably benign Het
Klhdc1 G A 12: 69,263,149 S275N probably damaging Het
Lrba A C 3: 86,395,246 N1871T probably damaging Het
Lrrk1 A G 7: 66,332,386 V169A probably damaging Het
Magi1 A G 6: 93,683,089 I1175T probably benign Het
Man1a2 T C 3: 100,582,053 T537A possibly damaging Het
Mrpl17 T C 7: 105,810,002 N129S probably damaging Het
Mup5 G A 4: 61,832,385 R174C probably damaging Het
Ndufaf1 G A 2: 119,658,396 R216C probably damaging Het
Neb T C 2: 52,334,659 probably null Het
Olfml3 T C 3: 103,735,860 K402E probably damaging Het
Olfr553 A T 7: 102,614,767 M74K probably damaging Het
Olfr76 T C 19: 12,120,548 T55A probably benign Het
Olfr875 G A 9: 37,773,415 G252D possibly damaging Het
Osbpl8 C T 10: 111,275,011 P458L possibly damaging Het
Pcdh20 T C 14: 88,469,075 E263G possibly damaging Het
Pkd1l1 A G 11: 8,945,241 L623P Het
Plxdc1 T C 11: 97,932,327 T363A possibly damaging Het
Pole3 T C 4: 62,524,050 D111G unknown Het
R3hdm2 T A 10: 127,458,153 L172Q probably damaging Het
Rbm33 T C 5: 28,394,324 V90A Het
Rcbtb1 C G 14: 59,228,379 I390M probably damaging Het
Romo1 G A 2: 156,144,375 probably benign Het
Sars A G 3: 108,428,203 Y410H probably damaging Het
Sesn2 T C 4: 132,497,413 T327A probably benign Het
Slc30a5 A G 13: 100,809,254 V530A probably damaging Het
Slc30a9 G A 5: 67,315,701 E43K probably benign Het
Slc38a2 A C 15: 96,691,359 L418W probably damaging Het
Snx14 T C 9: 88,394,561 E557G possibly damaging Het
Spata33 T A 8: 123,221,998 I123K probably damaging Het
Tdrd3 A T 14: 87,477,403 H170L probably damaging Het
Trpm1 A G 7: 64,219,106 probably null Het
Tsr3 A T 17: 25,242,595 E302D probably benign Het
Ttll11 A G 2: 35,902,673 I386T probably damaging Het
Usp2 C T 9: 44,075,969 T188M possibly damaging Het
Usp44 A G 10: 93,845,993 I102V probably benign Het
Wasf1 A G 10: 40,926,550 N67S probably benign Het
Zfp445 T C 9: 122,852,143 N911S probably benign Het
Zfp467 A G 6: 48,444,969 probably null Het
Other mutations in Anxa6
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01420:Anxa6 APN 11 54992363 missense probably damaging 1.00
IGL02450:Anxa6 APN 11 54994941 missense probably damaging 1.00
R0220:Anxa6 UTSW 11 54981762 splice site probably null
R0374:Anxa6 UTSW 11 55005828 missense probably benign 0.02
R0599:Anxa6 UTSW 11 54979466 missense possibly damaging 0.92
R0659:Anxa6 UTSW 11 54983347 missense probably damaging 0.99
R0924:Anxa6 UTSW 11 54994388 splice site probably null
R0930:Anxa6 UTSW 11 54994388 splice site probably null
R1005:Anxa6 UTSW 11 55001218 missense possibly damaging 0.89
R1435:Anxa6 UTSW 11 54991410 missense probably benign
R2314:Anxa6 UTSW 11 55011735 missense probably damaging 1.00
R2850:Anxa6 UTSW 11 55011026 missense possibly damaging 0.94
R4596:Anxa6 UTSW 11 54994583 splice site probably null
R5057:Anxa6 UTSW 11 55001236 missense possibly damaging 0.82
R5685:Anxa6 UTSW 11 54996370 missense probably benign
R5968:Anxa6 UTSW 11 54994341 missense probably damaging 1.00
R6145:Anxa6 UTSW 11 54994904 missense probably damaging 0.98
R6268:Anxa6 UTSW 11 54987077 splice site probably null
R6818:Anxa6 UTSW 11 54979500 missense probably benign
R6864:Anxa6 UTSW 11 54986185 missense probably benign
R7595:Anxa6 UTSW 11 54985085 missense probably benign 0.00
R7740:Anxa6 UTSW 11 55007899 missense probably damaging 1.00
R8084:Anxa6 UTSW 11 55004008 missense probably damaging 1.00
R8507:Anxa6 UTSW 11 55013870 missense probably benign 0.14
R8676:Anxa6 UTSW 11 55001282 nonsense probably null
R8818:Anxa6 UTSW 11 55011752 missense possibly damaging 0.93
R9226:Anxa6 UTSW 11 54994965 missense probably benign 0.34
R9227:Anxa6 UTSW 11 55007868 missense probably benign 0.03
Predicted Primers PCR Primer
(F):5'- CGATTCCTTATCCTAGGTGTGC -3'
(R):5'- AACCTCAATGCCCTTGGGTG -3'

Sequencing Primer
(F):5'- GTGTGCCATCTGCCTTGCTAAG -3'
(R):5'- CAATGCCCTTGGGTGATTGATCC -3'
Posted On 2019-06-26