Incidental Mutation 'R7318:Fry'
ID565640
Institutional Source Beutler Lab
Gene Symbol Fry
Ensembl Gene ENSMUSG00000056602
Gene NameFRY microtubule binding protein
Synonyms9330186A19Rik, cg003
MMRRC Submission
Accession Numbers
Is this an essential gene? Possibly essential (E-score: 0.748) question?
Stock #R7318 (G1)
Quality Score225.009
Status Validated
Chromosome5
Chromosomal Location150118645-150497753 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to T at 150436993 bp
ZygosityHeterozygous
Amino Acid Change Serine to Cysteine at position 2035 (S2035C)
Ref Sequence ENSEMBL: ENSMUSP00000084454 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000087204] [ENSMUST00000202566]
Predicted Effect probably damaging
Transcript: ENSMUST00000087204
AA Change: S2035C

PolyPhen 2 Score 0.977 (Sensitivity: 0.76; Specificity: 0.96)
SMART Domains Protein: ENSMUSP00000084454
Gene: ENSMUSG00000056602
AA Change: S2035C

DomainStartEndE-ValueType
Pfam:MOR2-PAG1_N 165 697 5.3e-170 PFAM
low complexity region 1014 1040 N/A INTRINSIC
Pfam:MOR2-PAG1_mid 1188 1380 1.2e-15 PFAM
Pfam:MOR2-PAG1_mid 1398 1534 1.5e-5 PFAM
Pfam:MOR2-PAG1_mid 1632 1704 1.8e-7 PFAM
Pfam:MOR2-PAG1_mid 1772 1906 4.9e-10 PFAM
low complexity region 1936 1956 N/A INTRINSIC
low complexity region 1962 1980 N/A INTRINSIC
Pfam:MOR2-PAG1_C 2050 2303 1.9e-74 PFAM
low complexity region 2369 2385 N/A INTRINSIC
low complexity region 2463 2482 N/A INTRINSIC
low complexity region 2525 2534 N/A INTRINSIC
low complexity region 2836 2852 N/A INTRINSIC
Predicted Effect possibly damaging
Transcript: ENSMUST00000202566
AA Change: S22C

PolyPhen 2 Score 0.773 (Sensitivity: 0.85; Specificity: 0.92)
SMART Domains Protein: ENSMUSP00000144657
Gene: ENSMUSG00000056602
AA Change: S22C

DomainStartEndE-ValueType
Pfam:MOR2-PAG1_C 37 290 1.5e-71 PFAM
low complexity region 356 372 N/A INTRINSIC
low complexity region 447 472 N/A INTRINSIC
low complexity region 515 524 N/A INTRINSIC
low complexity region 832 848 N/A INTRINSIC
Meta Mutation Damage Score 0.0728 question?
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.6%
  • 20x: 98.6%
Validation Efficiency 100% (67/67)
Allele List at MGI
Other mutations in this stock
Total: 66 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4930433I11Rik T C 7: 40,993,687 L260S probably benign Het
9130230L23Rik A T 5: 65,988,428 S113R unknown Het
Abcc5 G A 16: 20,392,543 P557S probably benign Het
Acad11 A G 9: 104,081,267 T245A probably damaging Het
Acap2 A G 16: 31,127,337 F263L probably damaging Het
Ankle2 A T 5: 110,237,766 N327I probably benign Het
Appl1 T C 14: 26,963,660 E67G probably benign Het
Arfgef3 A T 10: 18,630,463 C864S possibly damaging Het
Arhgap20 A G 9: 51,840,502 I418V probably benign Het
Arhgef2 A T 3: 88,632,303 N102Y probably damaging Het
Car9 G T 4: 43,513,089 E431D probably damaging Het
Cbfa2t2 T C 2: 154,500,454 I30T probably benign Het
Cd40 A T 2: 165,062,335 D34V possibly damaging Het
Chrnb2 T A 3: 89,763,367 probably null Het
Chsy1 T G 7: 66,110,229 probably null Het
Cpne6 A G 14: 55,514,294 T245A possibly damaging Het
Cpsf1 T A 15: 76,597,275 K1159* probably null Het
Crisp1 T A 17: 40,307,777 E64D possibly damaging Het
D3Ertd751e A G 3: 41,802,551 probably null Het
Dnah7b T A 1: 46,195,372 L1488Q probably damaging Het
Dnm2 G A 9: 21,505,567 G799R possibly damaging Het
E330009J07Rik A G 6: 40,409,164 V333A possibly damaging Het
Elp2 G A 18: 24,606,899 V61I probably damaging Het
Epb41l3 T C 17: 69,266,140 L388P Het
Fam19a1 T C 6: 96,115,756 probably null Het
Fam205c TCATTCAACACTTTGGAGAGCTCTGAACTCTGGCCATTCAACACTTTGGAGAGCTCTGAACTCTGGCCATTCAACACTTTGGAGAGCTCTGAACTCTGGTCATTCAACACTTTGG TCATTCAACACTTTGGAGAGCTCTGAACTCTGGCCATTCAACACTTTGGAGAGCTCTGAACTCTGGTCATTCAACACTTTGG 4: 42,871,823 probably benign Het
Gas8 T C 8: 123,530,968 F385L probably benign Het
Ghsr T C 3: 27,372,467 V224A possibly damaging Het
Gstp2 T A 19: 4,041,065 R85W probably benign Het
Ighv1-20 T A 12: 114,724,190 I6F possibly damaging Het
Inpp4b T A 8: 82,071,745 M854K probably damaging Het
Kif15 A G 9: 122,987,949 E538G probably damaging Het
Large2 T C 2: 92,366,028 T485A probably benign Het
Lmo3 T A 6: 138,421,365 probably benign Het
Lyg1 G A 1: 37,949,855 P95S probably benign Het
Lyst A G 13: 13,757,443 H3552R probably benign Het
Mtif2 C T 11: 29,540,115 S385L probably benign Het
Muc4 A T 16: 32,755,336 I1737F unknown Het
Mug1 T C 6: 121,870,652 probably null Het
Mx1 G T 16: 97,452,086 Q350K probably benign Het
Mylk3 G T 8: 85,359,097 D269E probably benign Het
Myo3a A T 2: 22,558,320 K974* probably null Het
Nectin4 G T 1: 171,380,463 R141L probably benign Het
Nlgn2 T C 11: 69,825,969 H582R probably damaging Het
Olfr558 T A 7: 102,710,019 Y253* probably null Het
Olfr613 T A 7: 103,552,091 M102K probably damaging Het
Pi16 C A 17: 29,319,234 P7Q possibly damaging Het
Psmd11 C A 11: 80,456,302 L171I probably benign Het
Rad54l A G 4: 116,110,709 V152A possibly damaging Het
Ranbp2 T A 10: 58,483,087 Y2473* probably null Het
Sertad1 T C 7: 27,489,485 I77T possibly damaging Het
Sesn3 A T 9: 14,308,577 E87D probably damaging Het
Slc30a5 A T 13: 100,813,969 S260R probably benign Het
Slc6a12 G A 6: 121,352,013 G111S probably damaging Het
Slc6a12 T C 6: 121,352,019 Y113H probably benign Het
Spag17 T G 3: 99,939,983 M76R probably benign Het
Stard13 G A 5: 151,062,573 Q491* probably null Het
Synpo2 T C 3: 123,117,319 S226G probably benign Het
Tada2b G A 5: 36,483,987 T24I probably benign Het
Tmem51 TCCCC TCCC 4: 142,037,685 probably null Het
Tnnt1 T A 7: 4,510,548 probably null Het
Usp17lb T C 7: 104,841,133 I196V probably benign Het
Utp20 T A 10: 88,813,949 K466N possibly damaging Het
Wdr46 T C 17: 33,941,885 probably null Het
Zfp287 T A 11: 62,714,278 Q601L probably damaging Het
Zfp410 T C 12: 84,325,690 S97P probably benign Het
Other mutations in Fry
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00327:Fry APN 5 150340404 nonsense probably null
IGL00328:Fry APN 5 150340404 nonsense probably null
IGL00841:Fry APN 5 150422724 missense probably benign
IGL00938:Fry APN 5 150370180 missense probably damaging 1.00
IGL01015:Fry APN 5 150422787 missense probably benign 0.18
IGL01401:Fry APN 5 150438788 missense probably benign
IGL01616:Fry APN 5 150399599 missense probably damaging 1.00
IGL01616:Fry APN 5 150438811 splice site probably null
IGL01748:Fry APN 5 150345651 splice site probably benign
IGL01965:Fry APN 5 150381621 missense probably damaging 1.00
IGL02030:Fry APN 5 150471618 splice site probably benign
IGL02079:Fry APN 5 150399624 missense probably damaging 0.97
IGL02087:Fry APN 5 150403594 missense probably benign 0.23
IGL02113:Fry APN 5 150399605 missense probably benign
IGL02209:Fry APN 5 150437026 missense probably benign 0.00
IGL02250:Fry APN 5 150403434 splice site probably benign
IGL02265:Fry APN 5 150437153 missense probably damaging 1.00
IGL02486:Fry APN 5 150491177 missense probably damaging 0.99
IGL02552:Fry APN 5 150380910 missense probably damaging 1.00
IGL02881:Fry APN 5 150359051 missense probably damaging 0.99
IGL03008:Fry APN 5 150345556 missense possibly damaging 0.82
IGL03140:Fry APN 5 150495701 missense probably damaging 0.98
IGL03171:Fry APN 5 150380809 missense probably damaging 1.00
IGL03389:Fry APN 5 150394231 missense probably damaging 1.00
IGL03404:Fry APN 5 150326168 missense probably damaging 1.00
Brook UTSW 5 150326132 missense probably damaging 1.00
miracle UTSW 5 150437159 missense probably damaging 0.99
quickening UTSW 5 150434776 missense probably damaging 1.00
seasons UTSW 5 150466437 missense probably benign 0.06
R0023:Fry UTSW 5 150451098 missense possibly damaging 0.78
R0024:Fry UTSW 5 150380803 missense probably benign 0.03
R0030:Fry UTSW 5 150372569 nonsense probably null
R0053:Fry UTSW 5 150461377 splice site probably benign
R0089:Fry UTSW 5 150340427 missense possibly damaging 0.91
R0212:Fry UTSW 5 150496397 missense probably damaging 0.99
R0241:Fry UTSW 5 150260346 intron probably benign
R0265:Fry UTSW 5 150434776 missense probably damaging 1.00
R0317:Fry UTSW 5 150471468 missense probably damaging 1.00
R0532:Fry UTSW 5 150433707 unclassified probably benign
R0532:Fry UTSW 5 150478761 splice site probably benign
R0599:Fry UTSW 5 150437159 missense probably damaging 0.99
R0631:Fry UTSW 5 150496352 missense possibly damaging 0.82
R0723:Fry UTSW 5 150496360 missense probably damaging 1.00
R0766:Fry UTSW 5 150403432 splice site probably benign
R0790:Fry UTSW 5 150466437 missense probably benign 0.06
R0928:Fry UTSW 5 150437084 missense probably damaging 1.00
R1104:Fry UTSW 5 150496289 missense probably damaging 1.00
R1144:Fry UTSW 5 150418464 missense possibly damaging 0.94
R1172:Fry UTSW 5 150481494 nonsense probably null
R1312:Fry UTSW 5 150403432 splice site probably benign
R1347:Fry UTSW 5 150495818 missense probably damaging 1.00
R1347:Fry UTSW 5 150495818 missense probably damaging 1.00
R1437:Fry UTSW 5 150310425 missense possibly damaging 0.92
R1458:Fry UTSW 5 150380859 missense probably damaging 1.00
R1542:Fry UTSW 5 150404966 missense probably benign 0.13
R1692:Fry UTSW 5 150370227 missense probably damaging 1.00
R1826:Fry UTSW 5 150436709 missense possibly damaging 0.82
R1874:Fry UTSW 5 150345921 missense probably damaging 1.00
R1875:Fry UTSW 5 150326132 missense probably damaging 1.00
R1881:Fry UTSW 5 150478046 missense probably damaging 0.97
R1884:Fry UTSW 5 150403520 missense probably benign 0.00
R1929:Fry UTSW 5 150400924 missense probably null 0.02
R2066:Fry UTSW 5 150370119 splice site probably benign
R2270:Fry UTSW 5 150400924 missense probably null 0.02
R2356:Fry UTSW 5 150471432 missense probably benign
R3720:Fry UTSW 5 150454572 missense probably damaging 1.00
R3773:Fry UTSW 5 150398198 missense probably damaging 0.96
R3824:Fry UTSW 5 150496419 missense possibly damaging 0.94
R3902:Fry UTSW 5 150345927 missense probably damaging 1.00
R3923:Fry UTSW 5 150413349 missense probably benign
R4250:Fry UTSW 5 150310360 missense probably damaging 0.99
R4332:Fry UTSW 5 150381663 missense probably damaging 1.00
R4495:Fry UTSW 5 150310463 missense probably damaging 1.00
R4610:Fry UTSW 5 150386104 missense probably damaging 1.00
R4682:Fry UTSW 5 150422754 missense probably damaging 1.00
R4732:Fry UTSW 5 150386007 missense possibly damaging 0.93
R4733:Fry UTSW 5 150386007 missense possibly damaging 0.93
R4755:Fry UTSW 5 150398254 missense probably damaging 0.99
R4788:Fry UTSW 5 150399636 missense probably benign 0.00
R4803:Fry UTSW 5 150399533 missense probably benign 0.31
R4858:Fry UTSW 5 150401643 missense possibly damaging 0.78
R4872:Fry UTSW 5 150394239 critical splice donor site probably null
R4902:Fry UTSW 5 150495703 missense probably benign 0.43
R4915:Fry UTSW 5 150478863 missense probably benign 0.30
R4938:Fry UTSW 5 150477989 missense probably damaging 1.00
R4983:Fry UTSW 5 150398254 missense probably damaging 1.00
R5004:Fry UTSW 5 150433604 missense probably benign 0.16
R5040:Fry UTSW 5 150388854 missense probably damaging 0.99
R5145:Fry UTSW 5 150370224 missense probably damaging 0.98
R5170:Fry UTSW 5 150429854 missense probably benign 0.03
R5233:Fry UTSW 5 150469720 missense possibly damaging 0.71
R5428:Fry UTSW 5 150405359 missense possibly damaging 0.89
R5468:Fry UTSW 5 150399588 missense probably benign 0.44
R5481:Fry UTSW 5 150260319 missense probably benign 0.01
R5494:Fry UTSW 5 150390667 missense probably damaging 1.00
R5538:Fry UTSW 5 150495848 missense probably damaging 1.00
R5638:Fry UTSW 5 150359081 missense possibly damaging 0.46
R5645:Fry UTSW 5 150380867 missense probably damaging 1.00
R5716:Fry UTSW 5 150370221 nonsense probably null
R5812:Fry UTSW 5 150399671 missense probably damaging 0.99
R5813:Fry UTSW 5 150399671 missense probably damaging 0.99
R5873:Fry UTSW 5 150378885 missense probably damaging 1.00
R5933:Fry UTSW 5 150390800 intron probably benign
R6037:Fry UTSW 5 150428179 missense probably benign 0.03
R6037:Fry UTSW 5 150428179 missense probably benign 0.03
R6158:Fry UTSW 5 150454572 missense probably damaging 1.00
R6178:Fry UTSW 5 150454522 missense probably damaging 1.00
R6481:Fry UTSW 5 150386014 missense probably damaging 1.00
R6562:Fry UTSW 5 150326149 missense probably damaging 1.00
R6676:Fry UTSW 5 150380922 missense probably benign 0.22
R6717:Fry UTSW 5 150496312 missense probably benign 0.00
R6828:Fry UTSW 5 150466446 splice site probably null
R6874:Fry UTSW 5 150437303 missense probably benign 0.00
R6930:Fry UTSW 5 150428230 missense probably benign 0.00
R6963:Fry UTSW 5 150457844 missense probably benign 0.17
R6965:Fry UTSW 5 150416220 missense possibly damaging 0.79
R7051:Fry UTSW 5 150395169 missense possibly damaging 0.93
R7085:Fry UTSW 5 150438749 missense probably benign 0.02
R7108:Fry UTSW 5 150395786 missense probably damaging 1.00
R7108:Fry UTSW 5 150491090 missense
R7115:Fry UTSW 5 150386067 missense probably damaging 1.00
R7116:Fry UTSW 5 150395869 critical splice donor site probably null
R7197:Fry UTSW 5 150469767 missense
R7256:Fry UTSW 5 150466786 missense
R7323:Fry UTSW 5 150496349 missense
R7358:Fry UTSW 5 150416323 missense probably benign
R7361:Fry UTSW 5 150436847 missense possibly damaging 0.92
R7395:Fry UTSW 5 150380883 missense possibly damaging 0.82
R7487:Fry UTSW 5 150414574 missense possibly damaging 0.79
R7491:Fry UTSW 5 150466326 missense
R7574:Fry UTSW 5 150380894 missense probably benign 0.00
R7582:Fry UTSW 5 150496382 missense
R7586:Fry UTSW 5 150426218 missense probably damaging 1.00
R7650:Fry UTSW 5 150413418 missense probably damaging 1.00
R7699:Fry UTSW 5 150405327 missense probably damaging 0.98
R7700:Fry UTSW 5 150405327 missense probably damaging 0.98
R7972:Fry UTSW 5 150310396 missense probably benign 0.05
R8058:Fry UTSW 5 150495767 missense
R8070:Fry UTSW 5 150478007 missense
R8159:Fry UTSW 5 150399533 missense probably benign 0.31
R8202:Fry UTSW 5 150431737 missense probably damaging 1.00
R8261:Fry UTSW 5 150445907 missense probably damaging 1.00
R8279:Fry UTSW 5 150496261 missense
R8338:Fry UTSW 5 150359051 missense probably damaging 0.99
R8370:Fry UTSW 5 150395819 missense probably damaging 1.00
Z1177:Fry UTSW 5 150310437 missense possibly damaging 0.80
Predicted Primers PCR Primer
(F):5'- GACAGCTGAACGTCAATCCC -3'
(R):5'- GGTGAGAGAGGTGAATCCCTTC -3'

Sequencing Primer
(F):5'- TGAACGTCAATCCCGGGACTC -3'
(R):5'- TGCTGTAGCCCTGGGAAGTC -3'
Posted On2019-06-26