Incidental Mutation 'R7427:Rhobtb1'
ID576190
Institutional Source Beutler Lab
Gene Symbol Rhobtb1
Ensembl Gene ENSMUSG00000019944
Gene NameRho-related BTB domain containing 1
Synonyms
MMRRC Submission
Accession Numbers
Is this an essential gene? Possibly non essential (E-score: 0.486) question?
Stock #R7427 (G1)
Quality Score225.009
Status Validated
Chromosome10
Chromosomal Location69151434-69291791 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to A at 69248824 bp
ZygosityHeterozygous
Amino Acid Change Isoleucine to Asparagine at position 15 (I15N)
Ref Sequence ENSEMBL: ENSMUSP00000020101 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000020101] [ENSMUST00000067908] [ENSMUST00000163497] [ENSMUST00000164034] [ENSMUST00000164212] [ENSMUST00000167286] [ENSMUST00000167384] [ENSMUST00000168117] [ENSMUST00000172261]
Predicted Effect probably damaging
Transcript: ENSMUST00000020101
AA Change: I15N

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000020101
Gene: ENSMUSG00000019944
AA Change: I15N

DomainStartEndE-ValueType
RHO 17 210 5.8e-34 SMART
low complexity region 225 246 N/A INTRINSIC
BTB 266 456 6.29e-13 SMART
BTB 484 582 9.03e-14 SMART
Predicted Effect probably damaging
Transcript: ENSMUST00000067908
AA Change: I15N

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000065095
Gene: ENSMUSG00000019944
AA Change: I15N

DomainStartEndE-ValueType
RHO 17 210 5.8e-34 SMART
low complexity region 225 246 N/A INTRINSIC
BTB 266 456 6.29e-13 SMART
BTB 484 582 9.03e-14 SMART
Predicted Effect probably damaging
Transcript: ENSMUST00000163497
AA Change: I15N

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000129119
Gene: ENSMUSG00000019944
AA Change: I15N

DomainStartEndE-ValueType
Pfam:Ras 16 96 1.8e-5 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000164034
AA Change: I15N

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000132068
Gene: ENSMUSG00000019944
AA Change: I15N

DomainStartEndE-ValueType
RHO 17 210 5.8e-34 SMART
low complexity region 225 246 N/A INTRINSIC
BTB 266 456 6.29e-13 SMART
BTB 484 582 9.03e-14 SMART
Predicted Effect probably damaging
Transcript: ENSMUST00000164212
AA Change: I15N

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000128356
Gene: ENSMUSG00000019944
AA Change: I15N

DomainStartEndE-ValueType
Pfam:Ras 16 94 1.8e-5 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000167286
AA Change: I15N

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000131313
Gene: ENSMUSG00000019944
AA Change: I15N

DomainStartEndE-ValueType
Pfam:Ras 16 93 1.7e-5 PFAM
Predicted Effect possibly damaging
Transcript: ENSMUST00000167384
AA Change: I15N

PolyPhen 2 Score 0.956 (Sensitivity: 0.79; Specificity: 0.95)
SMART Domains Protein: ENSMUSP00000131222
Gene: ENSMUSG00000019944
AA Change: I15N

DomainStartEndE-ValueType
PDB:3RYT|C 10 97 8e-6 PDB
SCOP:d1ky3a_ 15 150 8e-16 SMART
Blast:RHO 17 99 5e-50 BLAST
low complexity region 163 184 N/A INTRINSIC
BTB 204 394 6.29e-13 SMART
BTB 422 520 9.03e-14 SMART
Predicted Effect probably damaging
Transcript: ENSMUST00000168117
AA Change: I15N

PolyPhen 2 Score 0.998 (Sensitivity: 0.27; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000131509
Gene: ENSMUSG00000019944
AA Change: I15N

DomainStartEndE-ValueType
Pfam:Ras 16 97 1.9e-6 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000172261
AA Change: I15N

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000128667
Gene: ENSMUSG00000019944
AA Change: I15N

DomainStartEndE-ValueType
Pfam:Ras 16 95 1.8e-5 PFAM
Meta Mutation Damage Score 0.9476 question?
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 100.0%
  • 10x: 99.8%
  • 20x: 99.4%
Validation Efficiency 100% (78/78)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene belongs to the Rho family of the small GTPase superfamily. It contains a GTPase domain, a proline-rich region, a tandem of 2 BTB (broad complex, tramtrack, and bric-a-brac) domains, and a conserved C-terminal region. The protein plays a role in small GTPase-mediated signal transduction and the organization of the actin filament system. Alternate splicing results in multiple transcript variants. [provided by RefSeq, Dec 2008]
Allele List at MGI
Other mutations in this stock
Total: 78 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4931423N10Rik C T 2: 23,256,994 R337C probably benign Het
Adck5 T A 15: 76,594,385 C318S possibly damaging Het
Aspm T A 1: 139,457,616 C333S probably benign Het
B3gnt4 A G 5: 123,510,731 N53S probably damaging Het
Bpifb5 G A 2: 154,225,122 M98I probably benign Het
Cacna2d3 A G 14: 29,064,275 M585T probably damaging Het
Cbarp T C 10: 80,131,304 D701G probably damaging Het
Cntrl T A 2: 35,170,534 W1913R probably benign Het
Cry2 T C 2: 92,413,047 D483G possibly damaging Het
Csmd1 A G 8: 16,023,850 F2044L possibly damaging Het
Ctgf T G 10: 24,597,499 M312R probably damaging Het
Cxcl16 A G 11: 70,458,804 V78A possibly damaging Het
Cxcr6 A T 9: 123,810,240 Y109F probably benign Het
Cyb5b A G 8: 107,170,416 D106G probably benign Het
D630036H23Rik T C 12: 36,381,538 R154G unknown Het
Dnah9 T C 11: 65,955,219 T2998A probably benign Het
Focad T C 4: 88,368,751 S1254P unknown Het
Gm21886 A T 18: 80,089,652 L97Q probably damaging Het
Gm6614 T G 6: 142,003,508 probably null Het
Gpr158 A C 2: 21,827,318 L1076F probably benign Het
Hivep2 T C 10: 14,133,741 M1714T possibly damaging Het
Hlcs A G 16: 94,267,899 V154A probably benign Het
Hpdl A T 4: 116,820,865 L133Q probably damaging Het
Il1rn C A 2: 24,349,542 T150K probably benign Het
Il6st A G 13: 112,488,560 I237V probably benign Het
Inpp5f A G 7: 128,679,805 D510G probably damaging Het
Ism2 G T 12: 87,286,995 T92K possibly damaging Het
Kif13b T C 14: 64,788,460 I1422T probably benign Het
Kit G A 5: 75,645,847 V671I possibly damaging Het
Klhdc8a A T 1: 132,302,967 N190I probably damaging Het
Lad1 C T 1: 135,825,838 T41I probably damaging Het
Lrrc7 G T 3: 158,198,141 T294K probably benign Het
Megf8 C T 7: 25,338,371 R771C probably benign Het
Micu3 A C 8: 40,378,914 N440T possibly damaging Het
Mnx1 T C 5: 29,474,213 N291D unknown Het
Mthfr A G 4: 148,051,603 M378V probably benign Het
Mup2 A T 4: 60,138,454 D79E probably benign Het
Myzap T C 9: 71,505,183 T451A probably benign Het
Nlrp9c T C 7: 26,371,435 D907G probably benign Het
Nr1h4 T C 10: 89,498,405 E41G probably benign Het
Nup98 A T 7: 102,135,001 probably null Het
Nxpe5 A C 5: 138,239,760 Y194S probably damaging Het
Olfr1024 T A 2: 85,904,131 R308* probably null Het
Olfr1032 A T 2: 86,008,219 I148L probably benign Het
Olfr105-ps T C 17: 37,383,299 V244A probably damaging Het
Olfr1121 G T 2: 87,371,690 V53L probably benign Het
Olfr332 A G 11: 58,489,780 I325T probably benign Het
Olfr466 A G 13: 65,153,052 Y276C probably damaging Het
Olfr554 A G 7: 102,640,326 I27V probably benign Het
Omd A T 13: 49,592,269 E385V possibly damaging Het
Pcdh9 G T 14: 93,887,111 T541K probably damaging Het
Pdia6 T C 12: 17,278,545 V167A probably damaging Het
Phf7 C T 14: 31,240,413 R145Q possibly damaging Het
Pitx3 T C 19: 46,137,424 D20G possibly damaging Het
Plxnb1 T C 9: 109,108,168 V1139A probably benign Het
Pon2 A T 6: 5,268,995 N226K probably damaging Het
Ppp1r10 T A 17: 35,930,133 H642Q possibly damaging Het
Prom2 A G 2: 127,539,811 L195P probably damaging Het
Psg23 C T 7: 18,611,983 probably null Het
Rfx4 C A 10: 84,896,012 Q618K probably benign Het
Rhot2 A T 17: 25,841,609 V233E probably damaging Het
Ripply2 T C 9: 87,019,756 S112P possibly damaging Het
Slc12a1 C A 2: 125,214,132 T861N probably benign Het
Slc35f1 T A 10: 53,089,414 S308R probably damaging Het
Slc35f4 T A 14: 49,298,898 I427F probably damaging Het
Sned1 G A 1: 93,289,358 V1322I probably benign Het
Sprr2f G A 3: 92,365,944 V17M unknown Het
Srd5a3 A G 5: 76,154,643 H285R probably benign Het
Stab1 T C 14: 31,159,259 T605A probably benign Het
Syne1 T C 10: 5,273,718 Q3054R probably damaging Het
Tas1r1 T C 4: 152,038,308 T27A probably benign Het
Tmem150b A T 7: 4,716,210 V237E probably benign Het
Trpv6 C T 6: 41,625,153 M407I probably benign Het
Ttn T G 2: 76,720,354 D31528A probably damaging Het
Uroc1 A T 6: 90,346,362 D354V possibly damaging Het
Vmn2r69 T C 7: 85,411,259 I372M probably benign Het
Vmn2r93 A T 17: 18,326,410 H848L probably benign Het
Zfp971 T A 2: 178,033,174 C189S probably damaging Het
Other mutations in Rhobtb1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00657:Rhobtb1 APN 10 69270221 missense probably damaging 1.00
IGL01504:Rhobtb1 APN 10 69249698 missense probably damaging 1.00
IGL01561:Rhobtb1 APN 10 69270391 missense probably benign 0.17
IGL01924:Rhobtb1 APN 10 69270304 missense probably damaging 1.00
IGL02252:Rhobtb1 APN 10 69249685 missense probably damaging 1.00
IGL02334:Rhobtb1 APN 10 69285678 splice site probably benign
IGL02393:Rhobtb1 APN 10 69288987 missense probably damaging 1.00
IGL02514:Rhobtb1 APN 10 69289641 missense probably benign 0.00
IGL03192:Rhobtb1 APN 10 69248823 missense probably damaging 1.00
R1687:Rhobtb1 UTSW 10 69270279 missense probably damaging 1.00
R1713:Rhobtb1 UTSW 10 69272771 missense probably benign 0.05
R1713:Rhobtb1 UTSW 10 69272772 missense possibly damaging 0.61
R1750:Rhobtb1 UTSW 10 69279406 missense probably damaging 1.00
R2044:Rhobtb1 UTSW 10 69272863 splice site probably benign
R2312:Rhobtb1 UTSW 10 69270463 nonsense probably null
R2402:Rhobtb1 UTSW 10 69270424 missense probably benign 0.00
R3815:Rhobtb1 UTSW 10 69285693 missense possibly damaging 0.75
R4633:Rhobtb1 UTSW 10 69249613 splice site probably null
R4737:Rhobtb1 UTSW 10 69279497 critical splice donor site probably null
R4780:Rhobtb1 UTSW 10 69270153 missense probably benign 0.02
R4865:Rhobtb1 UTSW 10 69270724 missense probably benign 0.04
R5124:Rhobtb1 UTSW 10 69269901 critical splice acceptor site probably null
R5248:Rhobtb1 UTSW 10 69248785 missense probably damaging 1.00
R5304:Rhobtb1 UTSW 10 69269912 missense probably damaging 1.00
R5480:Rhobtb1 UTSW 10 69270733 missense possibly damaging 0.86
R5836:Rhobtb1 UTSW 10 69269989 missense probably damaging 1.00
R5951:Rhobtb1 UTSW 10 69270255 missense probably damaging 0.99
R6218:Rhobtb1 UTSW 10 69270456 missense probably benign 0.00
R6629:Rhobtb1 UTSW 10 69270316 missense possibly damaging 0.92
R6869:Rhobtb1 UTSW 10 69270226 missense probably damaging 0.99
R7081:Rhobtb1 UTSW 10 69266297 missense probably benign 0.29
R7260:Rhobtb1 UTSW 10 69270780 nonsense probably null
R7428:Rhobtb1 UTSW 10 69248824 missense probably damaging 1.00
R8054:Rhobtb1 UTSW 10 69248890 missense probably damaging 1.00
R8139:Rhobtb1 UTSW 10 69266290 missense probably damaging 1.00
R8144:Rhobtb1 UTSW 10 69289558 missense possibly damaging 0.89
Z1176:Rhobtb1 UTSW 10 69289551 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- AGCTTGAGTTTCCCTTCCAAAC -3'
(R):5'- CAACAGTGATGGCCAAAGTATTC -3'

Sequencing Primer
(F):5'- AAACTTCTTGCCCGTGCC -3'
(R):5'- CAGGGTCTCAAGTAGCTCAG -3'
Posted On2019-10-07