Incidental Mutation 'R7427:Tas1r1'
ID576163
Institutional Source Beutler Lab
Gene Symbol Tas1r1
Ensembl Gene ENSMUSG00000028950
Gene Nametaste receptor, type 1, member 1
SynonymsTR1, T1r1, Gpr70, T1R1
MMRRC Submission
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.062) question?
Stock #R7427 (G1)
Quality Score225.009
Status Validated
Chromosome4
Chromosomal Location152027914-152038568 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 152038308 bp
ZygosityHeterozygous
Amino Acid Change Threonine to Alanine at position 27 (T27A)
Ref Sequence ENSEMBL: ENSMUSP00000030792 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000030792] [ENSMUST00000084116] [ENSMUST00000103197]
Predicted Effect probably benign
Transcript: ENSMUST00000030792
AA Change: T27A

PolyPhen 2 Score 0.387 (Sensitivity: 0.90; Specificity: 0.89)
SMART Domains Protein: ENSMUSP00000030792
Gene: ENSMUSG00000028950
AA Change: T27A

DomainStartEndE-ValueType
signal peptide 1 21 N/A INTRINSIC
Pfam:ANF_receptor 75 456 1.7e-69 PFAM
Pfam:NCD3G 494 546 2.1e-15 PFAM
Pfam:7tm_3 578 815 3.9e-33 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000084116
SMART Domains Protein: ENSMUSP00000081133
Gene: ENSMUSG00000028948

DomainStartEndE-ValueType
low complexity region 24 42 N/A INTRINSIC
low complexity region 45 54 N/A INTRINSIC
low complexity region 79 106 N/A INTRINSIC
low complexity region 281 294 N/A INTRINSIC
Pfam:CLP1_P 322 480 7.5e-37 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000103197
SMART Domains Protein: ENSMUSP00000099486
Gene: ENSMUSG00000028948

DomainStartEndE-ValueType
low complexity region 24 42 N/A INTRINSIC
low complexity region 45 54 N/A INTRINSIC
low complexity region 79 106 N/A INTRINSIC
low complexity region 281 294 N/A INTRINSIC
Pfam:MobB 316 429 5.9e-18 PFAM
Pfam:Clp1 425 665 1.9e-67 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000131696
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 100.0%
  • 10x: 99.8%
  • 20x: 99.4%
Validation Efficiency 100% (78/78)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene is a G protein-coupled receptor and is a component of the heterodimeric amino acid taste receptor T1R1+3. The T1R1+3 receptor responds to L-amino acids but not to D-enantiomers or other compounds. Most amino acids that are perceived as sweet activate T1R1+3, and this activation is strictly dependent on an intact T1R1+3 heterodimer. Multiple transcript variants encoding different isoforms have been found for this gene. [provided by RefSeq, Jun 2010]
PHENOTYPE: Homozygous mutant mice show diminished behavioral and nervous responses to umami tastants. Response to sweet tastants is unimpaired. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 78 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4931423N10Rik C T 2: 23,256,994 R337C probably benign Het
Adck5 T A 15: 76,594,385 C318S possibly damaging Het
Aspm T A 1: 139,457,616 C333S probably benign Het
B3gnt4 A G 5: 123,510,731 N53S probably damaging Het
Bpifb5 G A 2: 154,225,122 M98I probably benign Het
Cacna2d3 A G 14: 29,064,275 M585T probably damaging Het
Cbarp T C 10: 80,131,304 D701G probably damaging Het
Cntrl T A 2: 35,170,534 W1913R probably benign Het
Cry2 T C 2: 92,413,047 D483G possibly damaging Het
Csmd1 A G 8: 16,023,850 F2044L possibly damaging Het
Ctgf T G 10: 24,597,499 M312R probably damaging Het
Cxcl16 A G 11: 70,458,804 V78A possibly damaging Het
Cxcr6 A T 9: 123,810,240 Y109F probably benign Het
Cyb5b A G 8: 107,170,416 D106G probably benign Het
D630036H23Rik T C 12: 36,381,538 R154G unknown Het
Dnah9 T C 11: 65,955,219 T2998A probably benign Het
Focad T C 4: 88,368,751 S1254P unknown Het
Gm21886 A T 18: 80,089,652 L97Q probably damaging Het
Gm6614 T G 6: 142,003,508 probably null Het
Gpr158 A C 2: 21,827,318 L1076F probably benign Het
Hivep2 T C 10: 14,133,741 M1714T possibly damaging Het
Hlcs A G 16: 94,267,899 V154A probably benign Het
Hpdl A T 4: 116,820,865 L133Q probably damaging Het
Il1rn C A 2: 24,349,542 T150K probably benign Het
Il6st A G 13: 112,488,560 I237V probably benign Het
Inpp5f A G 7: 128,679,805 D510G probably damaging Het
Ism2 G T 12: 87,286,995 T92K possibly damaging Het
Kif13b T C 14: 64,788,460 I1422T probably benign Het
Kit G A 5: 75,645,847 V671I possibly damaging Het
Klhdc8a A T 1: 132,302,967 N190I probably damaging Het
Lad1 C T 1: 135,825,838 T41I probably damaging Het
Lrrc7 G T 3: 158,198,141 T294K probably benign Het
Megf8 C T 7: 25,338,371 R771C probably benign Het
Micu3 A C 8: 40,378,914 N440T possibly damaging Het
Mnx1 T C 5: 29,474,213 N291D unknown Het
Mthfr A G 4: 148,051,603 M378V probably benign Het
Mup2 A T 4: 60,138,454 D79E probably benign Het
Myzap T C 9: 71,505,183 T451A probably benign Het
Nlrp9c T C 7: 26,371,435 D907G probably benign Het
Nr1h4 T C 10: 89,498,405 E41G probably benign Het
Nup98 A T 7: 102,135,001 probably null Het
Nxpe5 A C 5: 138,239,760 Y194S probably damaging Het
Olfr1024 T A 2: 85,904,131 R308* probably null Het
Olfr1032 A T 2: 86,008,219 I148L probably benign Het
Olfr105-ps T C 17: 37,383,299 V244A probably damaging Het
Olfr1121 G T 2: 87,371,690 V53L probably benign Het
Olfr332 A G 11: 58,489,780 I325T probably benign Het
Olfr466 A G 13: 65,153,052 Y276C probably damaging Het
Olfr554 A G 7: 102,640,326 I27V probably benign Het
Omd A T 13: 49,592,269 E385V possibly damaging Het
Pcdh9 G T 14: 93,887,111 T541K probably damaging Het
Pdia6 T C 12: 17,278,545 V167A probably damaging Het
Phf7 C T 14: 31,240,413 R145Q possibly damaging Het
Pitx3 T C 19: 46,137,424 D20G possibly damaging Het
Plxnb1 T C 9: 109,108,168 V1139A probably benign Het
Pon2 A T 6: 5,268,995 N226K probably damaging Het
Ppp1r10 T A 17: 35,930,133 H642Q possibly damaging Het
Prom2 A G 2: 127,539,811 L195P probably damaging Het
Psg23 C T 7: 18,611,983 probably null Het
Rfx4 C A 10: 84,896,012 Q618K probably benign Het
Rhobtb1 T A 10: 69,248,824 I15N probably damaging Het
Rhot2 A T 17: 25,841,609 V233E probably damaging Het
Ripply2 T C 9: 87,019,756 S112P possibly damaging Het
Slc12a1 C A 2: 125,214,132 T861N probably benign Het
Slc35f1 T A 10: 53,089,414 S308R probably damaging Het
Slc35f4 T A 14: 49,298,898 I427F probably damaging Het
Sned1 G A 1: 93,289,358 V1322I probably benign Het
Sprr2f G A 3: 92,365,944 V17M unknown Het
Srd5a3 A G 5: 76,154,643 H285R probably benign Het
Stab1 T C 14: 31,159,259 T605A probably benign Het
Syne1 T C 10: 5,273,718 Q3054R probably damaging Het
Tmem150b A T 7: 4,716,210 V237E probably benign Het
Trpv6 C T 6: 41,625,153 M407I probably benign Het
Ttn T G 2: 76,720,354 D31528A probably damaging Het
Uroc1 A T 6: 90,346,362 D354V possibly damaging Het
Vmn2r69 T C 7: 85,411,259 I372M probably benign Het
Vmn2r93 A T 17: 18,326,410 H848L probably benign Het
Zfp971 T A 2: 178,033,174 C189S probably damaging Het
Other mutations in Tas1r1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL02708:Tas1r1 APN 4 152028340 missense possibly damaging 0.82
IGL02867:Tas1r1 APN 4 152028278 missense probably damaging 1.00
R1547:Tas1r1 UTSW 4 152028419 missense probably damaging 1.00
R1775:Tas1r1 UTSW 4 152038218 nonsense probably null
R1803:Tas1r1 UTSW 4 152032248 missense probably damaging 0.99
R2037:Tas1r1 UTSW 4 152028170 missense probably damaging 1.00
R2083:Tas1r1 UTSW 4 152028391 missense probably benign 0.02
R3821:Tas1r1 UTSW 4 152034681 missense probably benign
R3912:Tas1r1 UTSW 4 152031924 missense probably damaging 0.97
R4227:Tas1r1 UTSW 4 152028272 missense probably damaging 0.99
R4272:Tas1r1 UTSW 4 152032157 missense possibly damaging 0.70
R4273:Tas1r1 UTSW 4 152032157 missense possibly damaging 0.70
R4818:Tas1r1 UTSW 4 152032674 missense probably benign 0.15
R5567:Tas1r1 UTSW 4 152038325 missense probably damaging 0.99
R6183:Tas1r1 UTSW 4 152032541 missense probably damaging 1.00
R7162:Tas1r1 UTSW 4 152032238 missense possibly damaging 0.91
R7535:Tas1r1 UTSW 4 152028362 missense probably benign 0.06
R7736:Tas1r1 UTSW 4 152032466 missense probably benign 0.17
R7796:Tas1r1 UTSW 4 152034755 missense probably benign 0.01
R8078:Tas1r1 UTSW 4 152028346 missense probably damaging 1.00
R8255:Tas1r1 UTSW 4 152032317 missense probably benign 0.18
Z1177:Tas1r1 UTSW 4 152032214 missense probably damaging 0.99
Predicted Primers PCR Primer
(F):5'- TGGTGCCTGAGCCTAAACTC -3'
(R):5'- ATGGGGTCTCAGGAATCCAC -3'

Sequencing Primer
(F):5'- TGAGCCTAAACTCAGAGCCTC -3'
(R):5'- GTTCCTGAGAGAGACCACAGC -3'
Posted On2019-10-07