Incidental Mutation 'R7451:Scai'
ID577690
Institutional Source Beutler Lab
Gene Symbol Scai
Ensembl Gene ENSMUSG00000035236
Gene Namesuppressor of cancer cell invasion
SynonymsA930041I02Rik
Accession Numbers
Is this an essential gene? Possibly essential (E-score: 0.509) question?
Stock #R7451 (G1)
Quality Score225.009
Status Not validated
Chromosome2
Chromosomal Location39066214-39190734 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 39125136 bp
ZygosityHeterozygous
Amino Acid Change Threonine to Alanine at position 94 (T94A)
Ref Sequence ENSEMBL: ENSMUSP00000037194 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000038874] [ENSMUST00000147433] [ENSMUST00000204093] [ENSMUST00000204404]
Predicted Effect probably damaging
Transcript: ENSMUST00000038874
AA Change: T94A

PolyPhen 2 Score 0.998 (Sensitivity: 0.27; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000037194
Gene: ENSMUSG00000035236
AA Change: T94A

DomainStartEndE-ValueType
Pfam:DUF3550 64 557 6.1e-216 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000147433
Predicted Effect probably damaging
Transcript: ENSMUST00000204093
AA Change: T94A

PolyPhen 2 Score 0.998 (Sensitivity: 0.27; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000145133
Gene: ENSMUSG00000035236
AA Change: T94A

DomainStartEndE-ValueType
Pfam:DUF3550 64 480 2.5e-177 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000204404
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 100.0%
  • 10x: 99.7%
  • 20x: 99.2%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a regulator of cell migration. The encoded protein appears to function in the RhoA (ras homolog gene family, member A)-Dia1 (diaphanous homolog 1) signal transduction pathway. Alternatively spliced transcript variants have been described. [provided by RefSeq, Feb 2010]
PHENOTYPE: Homozygous mice of both sexes are sub-fertile owing to compromised meiotic synapsis and homologous recombination-mediated double-strand break DNA repair. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 81 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700006E09Rik A T 11: 101,991,457 N147I possibly damaging Het
Abcb6 A G 1: 75,172,153 I794T probably damaging Het
Abcc5 T A 16: 20,375,070 H767L probably damaging Het
Adgrb2 A T 4: 130,014,557 M1031L probably damaging Het
Akna T A 4: 63,378,667 M891L probably benign Het
Aloxe3 C A 11: 69,142,920 T620K possibly damaging Het
Amph A G 13: 19,077,368 Y63C probably damaging Het
Asprv1 A G 6: 86,628,948 I259V probably benign Het
Atp7b C T 8: 22,014,684 W652* probably null Het
Atp8a2 C T 14: 59,791,181 D946N probably null Het
BC024063 T A 10: 82,108,742 N65K probably benign Het
Bean1 A T 8: 104,213,996 M154L probably benign Het
Cacna1c C T 6: 118,594,020 V2181M unknown Het
Cacna1g A G 11: 94,429,075 I1425T probably damaging Het
Caskin2 A G 11: 115,812,155 probably benign Het
Ccng2 C G 5: 93,273,343 S237R probably benign Het
Cfd T A 10: 79,891,528 V43E probably damaging Het
Chd9 GCCCC GCCC 8: 91,033,790 probably null Het
Chd9 T A 8: 91,033,818 S2064T probably benign Het
Cpsf2 T G 12: 102,000,792 V646G possibly damaging Het
Ctif T C 18: 75,519,803 D461G possibly damaging Het
Cyp3a41a T A 5: 145,699,740 E414D probably benign Het
Dagla A G 19: 10,253,355 V544A probably damaging Het
Dhx57 A T 17: 80,247,113 V1228E probably damaging Het
Eif2b3 T A 4: 117,052,796 L176* probably null Het
Fbxw26 T A 9: 109,732,623 I168L probably benign Het
Flt3 T A 5: 147,349,667 Y703F probably damaging Het
Frmpd1 C T 4: 45,279,558 P761L probably benign Het
Gabrd A G 4: 155,388,459 V89A possibly damaging Het
Galnt14 A T 17: 73,574,809 H98Q probably benign Het
Gli3 T C 13: 15,726,291 V1421A possibly damaging Het
Gprin2 A G 14: 34,195,805 S3P probably damaging Het
Ifi211 T G 1: 173,899,492 D362A probably damaging Het
Lars G T 18: 42,202,550 T1167K probably benign Het
Lce1b T C 3: 92,655,900 S109G unknown Het
Lrp2 T G 2: 69,513,333 E894A probably damaging Het
Mamdc4 A G 2: 25,564,461 V1081A possibly damaging Het
Mcub T C 3: 129,917,103 S227G possibly damaging Het
Mki67 A G 7: 135,699,351 I1318T probably benign Het
Mybl2 C T 2: 163,072,706 T248I possibly damaging Het
Myo9b A T 8: 71,352,188 H1441L probably benign Het
Neb C T 2: 52,201,454 V5339I probably benign Het
Nktr T A 9: 121,729,656 S88T probably damaging Het
Nup155 C T 15: 8,145,607 Q963* probably null Het
Oas1c A C 5: 120,802,142 L320V possibly damaging Het
Olfr108 C A 17: 37,446,305 S261R probably damaging Het
Olfr1254 A G 2: 89,789,109 M81T probably benign Het
Olfr1338 C T 4: 118,753,687 A286T probably benign Het
Olfr149 G A 9: 39,702,127 T214I probably damaging Het
Olfr325 A G 11: 58,581,690 Y282C probably damaging Het
Olfr548-ps1 T C 7: 102,542,254 I106T probably benign Het
Pcdhga7 A G 18: 37,716,004 S355G possibly damaging Het
Pde11a C T 2: 76,022,773 V834I possibly damaging Het
Pdzrn4 A T 15: 92,770,067 D700V possibly damaging Het
Pif1 C A 9: 65,588,348 P180Q probably benign Het
Pkig G T 2: 163,721,163 E5* probably null Het
Pla2r1 T A 2: 60,535,002 M75L probably damaging Het
Pllp T C 8: 94,676,243 S157G probably damaging Het
Ppfia1 A T 7: 144,508,210 H566Q probably benign Het
Ptpn13 A G 5: 103,527,095 D646G probably benign Het
Rab11fip5 T A 6: 85,341,556 T784S probably benign Het
Rad51ap2 T G 12: 11,457,981 S635A probably benign Het
Rce1 C T 19: 4,625,053 G111D probably damaging Het
Rcor3 C A 1: 192,137,876 G8V probably damaging Het
Rhox4d G A X: 37,518,992 G191E unknown Het
Rimbp2 C T 5: 128,788,371 V631I probably benign Het
Sfmbt1 G A 14: 30,816,811 A796T probably benign Het
Slc6a11 C A 6: 114,245,683 Y546* probably null Het
Slc7a2 T C 8: 40,912,649 S506P probably damaging Het
Synj2 T A 17: 6,029,791 N1098K possibly damaging Het
Tmem177 G A 1: 119,910,241 A236V probably damaging Het
Togaram1 T A 12: 64,996,975 D1249E probably damaging Het
Trav17 A T 14: 53,806,639 M1L probably damaging Het
Trim25 C A 11: 89,015,737 A433D possibly damaging Het
Trim69 T C 2: 122,168,027 F160S probably benign Het
Trio A T 15: 27,747,913 V1407E probably benign Het
Trpm7 A T 2: 126,826,737 M753K probably damaging Het
Ttc12 G T 9: 49,471,879 A75E probably benign Het
Uchl4 A T 9: 64,235,731 I165L probably benign Het
Uvrag A T 7: 99,140,913 L13Q unknown Het
Wwc2 G A 8: 47,864,575 R656W not run Het
Other mutations in Scai
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00434:Scai APN 2 39108394 missense probably damaging 1.00
IGL01366:Scai APN 2 39106961 missense probably benign 0.36
IGL01739:Scai APN 2 39094791 splice site probably benign
IGL02251:Scai APN 2 39099417 missense probably benign 0.01
IGL02274:Scai APN 2 39102317 unclassified probably benign
R0239:Scai UTSW 2 39075042 missense probably benign 0.00
R0239:Scai UTSW 2 39075042 missense probably benign 0.00
R0685:Scai UTSW 2 39103737 missense probably damaging 0.96
R0904:Scai UTSW 2 39075152 missense possibly damaging 0.90
R1655:Scai UTSW 2 39080117 missense possibly damaging 0.79
R1820:Scai UTSW 2 39106978 missense possibly damaging 0.82
R1913:Scai UTSW 2 39080081 missense probably damaging 1.00
R2068:Scai UTSW 2 39123013 missense probably damaging 1.00
R2183:Scai UTSW 2 39080126 missense probably benign 0.00
R3237:Scai UTSW 2 39150314 splice site probably benign
R3933:Scai UTSW 2 39075052 missense probably benign 0.44
R5460:Scai UTSW 2 39083573 missense probably damaging 1.00
R5460:Scai UTSW 2 39083574 missense probably damaging 1.00
R6089:Scai UTSW 2 39083554 nonsense probably null
R6377:Scai UTSW 2 39102328 missense probably benign 0.02
R6606:Scai UTSW 2 39075135 missense probably benign 0.00
R7034:Scai UTSW 2 39121135 missense probably damaging 1.00
R7037:Scai UTSW 2 39190621 missense probably benign 0.04
R7171:Scai UTSW 2 39106936 missense possibly damaging 0.48
R7737:Scai UTSW 2 39123022 missense probably damaging 0.96
Predicted Primers PCR Primer
(F):5'- GGAGCTAAGCAGACCTCACA -3'
(R):5'- GGAAAGTGTGTTCTGGTCTCTAGAA -3'

Sequencing Primer
(F):5'- GTGGCTCACAACCATCTGTAATGG -3'
(R):5'- CTGGTCTCTAGAATTATTTTTCC -3'
Posted On2019-10-07