Incidental Mutation 'R7454:Itgal'
ID577995
Institutional Source Beutler Lab
Gene Symbol Itgal
Ensembl Gene ENSMUSG00000030830
Gene Nameintegrin alpha L
SynonymsLFA-1, Ly-21, Cd11a, Ly-15
MMRRC Submission
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.163) question?
Stock #R7454 (G1)
Quality Score225.009
Status Validated
Chromosome7
Chromosomal Location127296260-127335138 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) C to A at 127327764 bp
ZygosityHeterozygous
Amino Acid Change Glutamine to Lysine at position 943 (Q943K)
Ref Sequence ENSEMBL: ENSMUSP00000113396 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000106306] [ENSMUST00000117762] [ENSMUST00000118405] [ENSMUST00000120857] [ENSMUST00000170971]
Predicted Effect probably benign
Transcript: ENSMUST00000106306
AA Change: Q944K

PolyPhen 2 Score 0.012 (Sensitivity: 0.96; Specificity: 0.78)
SMART Domains Protein: ENSMUSP00000101913
Gene: ENSMUSG00000030830
AA Change: Q944K

DomainStartEndE-ValueType
signal peptide 1 23 N/A INTRINSIC
Int_alpha 38 81 5.01e0 SMART
VWA 151 327 2.68e-32 SMART
Int_alpha 398 450 1.27e-6 SMART
Int_alpha 454 509 9.6e-7 SMART
Int_alpha 515 568 3.58e-15 SMART
Int_alpha 575 624 1.28e1 SMART
low complexity region 1043 1059 N/A INTRINSIC
transmembrane domain 1087 1109 N/A INTRINSIC
Pfam:Integrin_alpha 1110 1124 5.8e-7 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000117762
AA Change: Q943K

PolyPhen 2 Score 0.012 (Sensitivity: 0.96; Specificity: 0.78)
SMART Domains Protein: ENSMUSP00000113946
Gene: ENSMUSG00000030830
AA Change: Q943K

DomainStartEndE-ValueType
signal peptide 1 23 N/A INTRINSIC
Int_alpha 38 81 5.01e0 SMART
VWA 151 327 2.68e-32 SMART
Int_alpha 398 450 1.27e-6 SMART
Int_alpha 454 509 9.6e-7 SMART
Int_alpha 515 568 3.58e-15 SMART
Int_alpha 575 624 1.28e1 SMART
low complexity region 1042 1058 N/A INTRINSIC
transmembrane domain 1086 1108 N/A INTRINSIC
Pfam:Integrin_alpha 1109 1123 5.8e-7 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000118405
AA Change: Q547K

PolyPhen 2 Score 0.012 (Sensitivity: 0.96; Specificity: 0.78)
SMART Domains Protein: ENSMUSP00000112591
Gene: ENSMUSG00000030830
AA Change: Q547K

DomainStartEndE-ValueType
Int_alpha 2 54 4.21e-3 SMART
Int_alpha 58 113 9.6e-7 SMART
Int_alpha 119 172 3.58e-15 SMART
Int_alpha 179 228 1.28e1 SMART
low complexity region 646 662 N/A INTRINSIC
transmembrane domain 690 712 N/A INTRINSIC
Pfam:Integrin_alpha 713 727 2.1e-7 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000120857
AA Change: Q943K

PolyPhen 2 Score 0.002 (Sensitivity: 0.99; Specificity: 0.30)
SMART Domains Protein: ENSMUSP00000113396
Gene: ENSMUSG00000030830
AA Change: Q943K

DomainStartEndE-ValueType
signal peptide 1 23 N/A INTRINSIC
Int_alpha 38 81 5.01e0 SMART
VWA 151 327 2.68e-32 SMART
Int_alpha 398 450 1.27e-6 SMART
Int_alpha 454 509 9.6e-7 SMART
Int_alpha 515 568 3.58e-15 SMART
Int_alpha 575 624 1.28e1 SMART
low complexity region 1042 1058 N/A INTRINSIC
transmembrane domain 1086 1108 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000170971
AA Change: Q943K

PolyPhen 2 Score 0.012 (Sensitivity: 0.96; Specificity: 0.78)
SMART Domains Protein: ENSMUSP00000131847
Gene: ENSMUSG00000030830
AA Change: Q943K

DomainStartEndE-ValueType
signal peptide 1 23 N/A INTRINSIC
Int_alpha 38 81 5.01e0 SMART
VWA 151 327 2.68e-32 SMART
Int_alpha 398 450 1.27e-6 SMART
Int_alpha 454 509 9.6e-7 SMART
Int_alpha 515 568 3.58e-15 SMART
Int_alpha 575 624 1.28e1 SMART
low complexity region 1042 1058 N/A INTRINSIC
transmembrane domain 1086 1108 N/A INTRINSIC
Pfam:Integrin_alpha 1109 1123 1.2e-6 PFAM
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 100.0%
  • 10x: 99.7%
  • 20x: 99.1%
Validation Efficiency 100% (90/90)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] ITGAL encodes the integrin alpha L chain. Integrins are heterodimeric integral membrane proteins composed of an alpha chain and a beta chain. This I-domain containing alpha integrin combines with the beta 2 chain (ITGB2) to form the integrin lymphocyte function-associated antigen-1 (LFA-1), which is expressed on all leukocytes. LFA-1 plays a central role in leukocyte intercellular adhesion through interactions with its ligands, ICAMs 1-3 (intercellular adhesion molecules 1 through 3), and also functions in lymphocyte costimulatory signaling. Two transcript variants encoding different isoforms have been found for this gene. [provided by RefSeq, Jul 2008]
PHENOTYPE: Nullizygous mutations of this gene lead to increased leukocyte cell number, alter T cell activation, leukocyte migration and adhesion, spleen and lymph node morphology, and may affect humoral immune responses, metastatic potential, and susceptibility to endotoxin shock. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 89 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2510002D24Rik A G 16: 18,836,851 E57G possibly damaging Het
4932414N04Rik C A 2: 68,688,304 T159K unknown Het
Adamts10 T A 17: 33,545,005 F616L possibly damaging Het
Adtrp G A 13: 41,828,315 S26L unknown Het
Alpk3 A C 7: 81,078,562 E480A probably benign Het
Anks6 T C 4: 47,038,919 T529A unknown Het
Arl4d A G 11: 101,666,660 H4R probably benign Het
Ash1l A G 3: 88,983,865 H1017R probably benign Het
Bbs12 T C 3: 37,320,953 S517P possibly damaging Het
Bcl11b C A 12: 107,916,208 R616L possibly damaging Het
Bean1 G A 8: 104,211,026 G79D probably damaging Het
Bicra C G 7: 15,972,134 G1461R probably benign Het
Bptf T C 11: 107,044,640 T124A probably benign Het
Btnl4 A T 17: 34,472,374 V312E probably benign Het
Ccdc7a A G 8: 128,944,516 M503T unknown Het
Celf5 T C 10: 81,482,523 E28G probably damaging Het
Cilp2 G A 8: 69,883,390 L350F probably damaging Het
Clec4a2 T C 6: 123,142,452 I245T probably damaging Het
Ctnnal1 A T 4: 56,844,544 V140D probably damaging Het
Dennd4a A C 9: 64,852,570 H319P probably damaging Het
Dlgap3 G T 4: 127,235,059 L857F probably null Het
Dnah6 T A 6: 73,212,492 T58S probably damaging Het
Dnah7a T A 1: 53,518,764 M2164L probably benign Het
Dspp T A 5: 104,175,610 H206Q probably benign Het
Dzip1l G A 9: 99,659,674 V443M possibly damaging Het
Erc2 A G 14: 28,302,991 H939R possibly damaging Het
Fam149a G T 8: 45,348,546 H513N probably benign Het
Fam171a2 T C 11: 102,439,717 T280A possibly damaging Het
Fam208b A G 13: 3,585,332 S492P probably benign Het
Fkbp5 A C 17: 28,416,025 V170G probably damaging Het
Fnbp4 ACCACCTCCACCTCCACCTCC ACCACCTCCACCTCCACCTCCACCTCC 2: 90,777,815 probably benign Het
Fzd2 T C 11: 102,605,129 F133S probably damaging Het
Galm A G 17: 80,138,121 N100S possibly damaging Het
Gbp2b T A 3: 142,598,159 I5N possibly damaging Het
Gga2 T C 7: 122,002,146 R245G probably benign Het
Gm10053 A G 19: 24,875,900 T50A probably benign Het
Gm1110 T C 9: 26,920,649 T69A probably benign Het
Gm15922 T G 7: 3,735,510 E622D probably benign Het
Heatr5a T C 12: 51,961,543 S6G probably benign Het
Hmcn1 A G 1: 150,563,604 S5610P probably damaging Het
Hmgb4 A G 4: 128,260,406 V123A probably damaging Het
Jakmip1 C A 5: 37,175,154 D1059E probably damaging Het
Jazf1 T C 6: 52,893,944 probably null Het
Kat6a A G 8: 22,935,772 E1111G possibly damaging Het
Kdm4b C A 17: 56,389,639 P452T probably benign Het
Krit1 T C 5: 3,812,474 Y210H probably damaging Het
Krtap6-2 A T 16: 89,419,912 Y56N unknown Het
Lig1 A T 7: 13,288,721 D158V probably damaging Het
Lmo1 A T 7: 109,140,666 L94Q probably benign Het
Lrrc30 A T 17: 67,632,243 L114H probably damaging Het
Ltn1 T C 16: 87,397,812 I1400V probably benign Het
Mark3 T C 12: 111,604,527 I87T probably damaging Het
Mfrp G T 9: 44,105,183 V392F possibly damaging Het
Mrgprg A G 7: 143,765,135 L80P probably damaging Het
Ndufaf3 A T 9: 108,566,926 M1K probably null Het
Nme7 T A 1: 164,380,648 L295* probably null Het
Noct G T 3: 51,249,730 C163F probably damaging Het
Olfr1270 T A 2: 90,149,419 I196F possibly damaging Het
Olfr229 A G 9: 39,909,904 I34V probably benign Het
Olfr541 A T 7: 140,704,634 I128F probably damaging Het
Olfr747 T A 14: 50,680,824 Q270L possibly damaging Het
Olfr772 T A 10: 129,174,455 T189S probably damaging Het
Olfr992 T A 2: 85,399,611 K307N probably damaging Het
Patz1 C T 11: 3,298,297 probably benign Het
Per3 A G 4: 151,012,728 L780P probably benign Het
Pla2g4a T C 1: 149,872,690 M256V possibly damaging Het
Pnliprp1 A G 19: 58,741,100 K395R probably benign Het
Poc5 G T 13: 96,400,832 G242V possibly damaging Het
Ppfia4 A G 1: 134,324,135 S434P possibly damaging Het
Prss42 A G 9: 110,798,829 N110S probably benign Het
Ralgapb T A 2: 158,432,902 I241N possibly damaging Het
Rbak A C 5: 143,173,773 Y508* probably null Het
S1pr2 G T 9: 20,967,549 R328S possibly damaging Het
Sap130 T C 18: 31,650,512 M214T probably benign Het
Slc46a1 T A 11: 78,466,511 V130E probably damaging Het
Smc4 A T 3: 69,018,124 H343L probably benign Het
Tarbp1 C A 8: 126,457,677 R500L probably benign Het
Tgfbr3 A T 5: 107,215,028 H39Q probably damaging Het
Tpp2 T C 1: 43,954,659 S235P probably benign Het
Trbc2 G T 6: 41,546,829 R33M Het
Trim3 C T 7: 105,619,558 R63Q probably damaging Het
Ttc28 T C 5: 111,285,484 V2128A probably benign Het
Ttn C T 2: 76,725,818 R30281H probably damaging Het
Ttn T A 2: 76,944,139 Q2187L unknown Het
Ttyh3 T C 5: 140,629,425 S403G possibly damaging Het
Vmn2r112 A T 17: 22,603,307 D322V probably benign Het
Wdr38 C T 2: 38,998,340 probably benign Het
Xrn1 T A 9: 96,048,358 S1543R probably benign Het
Zbtb8b G A 4: 129,432,769 T201I possibly damaging Het
Other mutations in Itgal
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00987:Itgal APN 7 127302011 missense probably damaging 0.99
IGL01300:Itgal APN 7 127314118 missense probably damaging 1.00
IGL01345:Itgal APN 7 127300956 missense possibly damaging 0.56
IGL01826:Itgal APN 7 127302146 missense probably benign 0.16
IGL02202:Itgal APN 7 127330179 nonsense probably null
IGL02212:Itgal APN 7 127300980 missense probably benign 0.00
IGL02513:Itgal APN 7 127328672 missense possibly damaging 0.78
IGL02608:Itgal APN 7 127310244 missense probably damaging 1.00
IGL02946:Itgal APN 7 127314368 missense probably damaging 0.99
sunglow UTSW 7 127328747 missense probably null 0.89
R0069:Itgal UTSW 7 127310331 missense probably benign 0.44
R0069:Itgal UTSW 7 127310331 missense probably benign 0.44
R0107:Itgal UTSW 7 127328559 splice site probably benign
R0331:Itgal UTSW 7 127306681 unclassified probably null
R0350:Itgal UTSW 7 127322081 missense probably damaging 1.00
R0380:Itgal UTSW 7 127310751 nonsense probably null
R0537:Itgal UTSW 7 127311273 missense possibly damaging 0.61
R0546:Itgal UTSW 7 127310314 missense probably benign 0.00
R0594:Itgal UTSW 7 127314060 missense probably damaging 1.00
R1167:Itgal UTSW 7 127300939 missense probably damaging 1.00
R1377:Itgal UTSW 7 127321917 missense probably damaging 1.00
R1575:Itgal UTSW 7 127300888 critical splice acceptor site probably null
R1690:Itgal UTSW 7 127302117 missense possibly damaging 0.56
R1693:Itgal UTSW 7 127305281 missense probably damaging 1.00
R1702:Itgal UTSW 7 127305025 missense probably benign 0.00
R1720:Itgal UTSW 7 127306927 missense probably benign 0.00
R1774:Itgal UTSW 7 127309622 critical splice donor site probably null
R1824:Itgal UTSW 7 127314060 missense probably damaging 1.00
R1878:Itgal UTSW 7 127310671 missense probably benign 0.44
R1951:Itgal UTSW 7 127330145 missense probably damaging 1.00
R2265:Itgal UTSW 7 127306701 missense possibly damaging 0.63
R2267:Itgal UTSW 7 127306701 missense possibly damaging 0.63
R2269:Itgal UTSW 7 127306701 missense possibly damaging 0.63
R2276:Itgal UTSW 7 127328747 missense probably null 0.89
R2570:Itgal UTSW 7 127314096 missense probably damaging 1.00
R3925:Itgal UTSW 7 127324537 splice site probably benign
R4225:Itgal UTSW 7 127305312 missense probably damaging 1.00
R4377:Itgal UTSW 7 127328281 missense probably benign 0.00
R4466:Itgal UTSW 7 127328512 missense possibly damaging 0.93
R4579:Itgal UTSW 7 127305294 missense possibly damaging 0.83
R4656:Itgal UTSW 7 127322553 missense probably damaging 1.00
R4771:Itgal UTSW 7 127328233 missense probably damaging 1.00
R5012:Itgal UTSW 7 127299630 critical splice donor site probably null
R5328:Itgal UTSW 7 127311675 critical splice donor site probably null
R5365:Itgal UTSW 7 127305350 missense probably damaging 0.98
R5579:Itgal UTSW 7 127306929 missense probably benign 0.10
R5849:Itgal UTSW 7 127317320 missense probably benign 0.27
R5955:Itgal UTSW 7 127304989 missense possibly damaging 0.82
R6254:Itgal UTSW 7 127325203 missense probably damaging 1.00
R6269:Itgal UTSW 7 127330217 missense probably null 1.00
R6520:Itgal UTSW 7 127330331 missense probably benign 0.01
R6541:Itgal UTSW 7 127311562 missense probably damaging 0.99
R7049:Itgal UTSW 7 127296401 unclassified probably benign
R7168:Itgal UTSW 7 127330213 missense probably benign
R7419:Itgal UTSW 7 127306875 missense probably benign 0.01
R7424:Itgal UTSW 7 127317365 missense probably benign 0.00
R7567:Itgal UTSW 7 127299788 missense probably benign 0.00
R7696:Itgal UTSW 7 127330184 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- TCTAGATGACAAGGTGCCTCTG -3'
(R):5'- AGTGCATCATGACAGACCAC -3'

Sequencing Primer
(F):5'- TCTGAAGGCCCCAGCACAG -3'
(R):5'- GGCTGCTCTTCTAAAGGACTCAG -3'
Posted On2019-10-07