Incidental Mutation 'R7466:Wdr12'
ID578739
Institutional Source Beutler Lab
Gene Symbol Wdr12
Ensembl Gene ENSMUSG00000026019
Gene NameWD repeat domain 12
SynonymsYtm1p, 4933402C23Rik, Ytm1
MMRRC Submission
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R7466 (G1)
Quality Score225.009
Status Validated
Chromosome1
Chromosomal Location60069785-60098645 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to T at 60094511 bp
ZygosityHeterozygous
Amino Acid Change Aspartic acid to Glutamic Acid at position 19 (D19E)
Ref Sequence ENSEMBL: ENSMUSP00000117391 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000027173] [ENSMUST00000117438] [ENSMUST00000122038] [ENSMUST00000124986] [ENSMUST00000130075] [ENSMUST00000141417] [ENSMUST00000143342]
Predicted Effect probably benign
Transcript: ENSMUST00000027173
AA Change: D19E

PolyPhen 2 Score 0.084 (Sensitivity: 0.93; Specificity: 0.85)
SMART Domains Protein: ENSMUSP00000027173
Gene: ENSMUSG00000026019
AA Change: D19E

DomainStartEndE-ValueType
Pfam:NLE 3 70 1.4e-20 PFAM
low complexity region 78 87 N/A INTRINSIC
WD40 91 127 5.97e-1 SMART
WD40 129 171 5.77e-5 SMART
WD40 178 217 2.04e-5 SMART
WD40 246 284 1.41e-8 SMART
WD40 287 325 2.69e-5 SMART
WD40 331 371 4.34e-9 SMART
WD40 375 413 3e-3 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000117438
AA Change: D19E

PolyPhen 2 Score 0.084 (Sensitivity: 0.93; Specificity: 0.85)
SMART Domains Protein: ENSMUSP00000113494
Gene: ENSMUSG00000026019
AA Change: D19E

DomainStartEndE-ValueType
Pfam:NLE 4 70 2e-19 PFAM
low complexity region 78 87 N/A INTRINSIC
WD40 91 127 5.97e-1 SMART
WD40 129 171 5.77e-5 SMART
WD40 178 217 2.04e-5 SMART
WD40 246 284 1.41e-8 SMART
WD40 287 325 2.69e-5 SMART
WD40 331 371 4.34e-9 SMART
WD40 375 413 3e-3 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000122038
AA Change: D19E

PolyPhen 2 Score 0.084 (Sensitivity: 0.93; Specificity: 0.85)
SMART Domains Protein: ENSMUSP00000113148
Gene: ENSMUSG00000026019
AA Change: D19E

DomainStartEndE-ValueType
Pfam:NLE 3 70 1.4e-20 PFAM
low complexity region 78 87 N/A INTRINSIC
WD40 91 127 5.97e-1 SMART
WD40 129 171 5.77e-5 SMART
WD40 178 217 2.04e-5 SMART
WD40 246 284 1.41e-8 SMART
WD40 287 325 2.69e-5 SMART
WD40 331 371 4.34e-9 SMART
WD40 375 413 3e-3 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000124986
Predicted Effect probably benign
Transcript: ENSMUST00000130075
Predicted Effect noncoding transcript
Transcript: ENSMUST00000133767
Predicted Effect probably benign
Transcript: ENSMUST00000141417
AA Change: D19E

PolyPhen 2 Score 0.084 (Sensitivity: 0.93; Specificity: 0.85)
SMART Domains Protein: ENSMUSP00000117747
Gene: ENSMUSG00000026019
AA Change: D19E

DomainStartEndE-ValueType
Pfam:NLE 3 70 3.2e-22 PFAM
low complexity region 78 87 N/A INTRINSIC
WD40 91 127 5.97e-1 SMART
Blast:WD40 129 151 4e-7 BLAST
Predicted Effect probably benign
Transcript: ENSMUST00000143342
AA Change: D19E

PolyPhen 2 Score 0.084 (Sensitivity: 0.93; Specificity: 0.85)
SMART Domains Protein: ENSMUSP00000117391
Gene: ENSMUSG00000026019
AA Change: D19E

DomainStartEndE-ValueType
Pfam:NLE 3 70 3.2e-22 PFAM
low complexity region 78 87 N/A INTRINSIC
WD40 91 127 5.97e-1 SMART
Blast:WD40 129 151 4e-7 BLAST
Predicted Effect noncoding transcript
Transcript: ENSMUST00000150008
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 100.0%
  • 10x: 99.8%
  • 20x: 99.2%
Validation Efficiency 99% (83/84)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of the WD repeat protein family. WD repeats are minimally conserved regions of approximately 40 amino acids typically bracketed by gly-his and trp-asp (GH-WD), which may facilitate formation of heterotrimeric or multiprotein complexes. Members of this family are involved in a variety of cellular processes, including cell cycle progression, signal transduction, apoptosis, and gene regulation. This protein is highly similar to the mouse WD repeat domain 12 protein at the amino acid level. The protein encoded by this gene is a component of a nucleolar protein complex that affects maturation of the large ribosomal subunit.[provided by RefSeq, Dec 2008]
Allele List at MGI
Other mutations in this stock
Total: 83 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
AI182371 T A 2: 35,088,741 K203* probably null Het
Akr1c13 T C 13: 4,192,437 probably benign Het
Amer3 A G 1: 34,587,993 S438G probably damaging Het
Aqp9 T A 9: 71,163,261 probably null Het
Art4 G T 6: 136,854,850 H98N probably damaging Het
Bdh1 T C 16: 31,447,604 S70P probably benign Het
Ccdc61 A C 7: 18,891,105 Y503D probably damaging Het
Cd163l1 T C 7: 140,220,706 probably null Het
Cd180 A T 13: 102,704,995 N183I probably damaging Het
Cd200r2 C T 16: 44,909,174 A64V probably damaging Het
Ceacam9 A C 7: 16,723,855 K98Q probably benign Het
Cep44 AACGC A 8: 56,540,983 probably null Het
Cfap77 G T 2: 28,955,613 D247E probably benign Het
Cftr T C 6: 18,227,973 M388T probably benign Het
Chrnb1 G A 11: 69,784,650 H493Y probably damaging Het
Ckap2 A C 8: 22,177,386 M153R probably benign Het
Cnot6l A G 5: 96,131,128 V77A probably benign Het
Col12a1 C T 9: 79,655,407 E1798K possibly damaging Het
Cth T A 3: 157,924,885 D49V probably benign Het
Ctnnb1 T C 9: 120,955,416 S425P probably damaging Het
Ctnnd1 T C 2: 84,610,785 N690S probably benign Het
Cyhr1 C T 15: 76,648,186 D241N probably benign Het
Dennd4c A G 4: 86,774,331 D26G probably damaging Het
Dlg5 G A 14: 24,245,212 P80L probably damaging Het
Eef2k A G 7: 120,903,484 probably null Het
Ephb2 C T 4: 136,659,065 R791H probably damaging Het
Erh T C 12: 80,640,983 Y22C probably benign Het
F5 C T 1: 164,193,328 T1124I possibly damaging Het
Fam220a T A 5: 143,563,471 C213S possibly damaging Het
Fat2 G T 11: 55,310,432 N605K probably damaging Het
Ganab C A 19: 8,914,569 S780* probably null Het
Gbgt1 C T 2: 28,502,207 P67S probably damaging Het
Gm17190 G T 13: 96,082,779 G208* probably null Het
Grhl2 A G 15: 37,291,616 Y316C probably damaging Het
H2-T10 T C 17: 36,120,849 T38A probably benign Het
Ins1 A G 19: 52,264,420 probably benign Het
Ippk T C 13: 49,432,467 probably null Het
Klc4 T A 17: 46,639,910 I258F probably benign Het
Manba C A 3: 135,542,393 L348I probably benign Het
Mgam A G 6: 40,744,789 N347S probably benign Het
Myo18b T C 5: 112,723,892 T2108A probably benign Het
Naip5 A T 13: 100,221,986 L914* probably null Het
Nsa2 C T 13: 97,131,220 A242T probably benign Het
Nsd2 G A 5: 33,882,147 W834* probably null Het
Olfr1134 T C 2: 87,656,396 N175S possibly damaging Het
Olfr1419 T A 19: 11,870,316 D300V possibly damaging Het
Olfr285 T C 15: 98,313,380 M57V probably damaging Het
Olfr469 A T 7: 107,822,922 C182* probably null Het
Pam A T 1: 97,842,247 D599E probably damaging Het
Phf20l1 A G 15: 66,636,884 K864R probably damaging Het
Plcl2 A G 17: 50,608,468 D835G probably damaging Het
Ppm1m C A 9: 106,196,157 A329S probably damaging Het
Prep T C 10: 45,150,438 V486A probably benign Het
Prkcb A T 7: 122,516,844 N182I probably damaging Het
Prkcz A G 4: 155,271,602 F355S probably damaging Het
Psg20 C T 7: 18,684,467 S125N probably benign Het
Psmd12 A G 11: 107,492,057 D234G probably benign Het
Pvrig A T 5: 138,342,008 M14L probably benign Het
Rabgap1l C T 1: 160,226,484 probably null Het
Rfc1 A T 5: 65,275,426 C764S probably damaging Het
Ryr3 T C 2: 112,926,957 D351G probably benign Het
Serpinb9g T C 13: 33,495,167 F340S probably benign Het
Sirpb1c C A 3: 15,832,266 L315F probably damaging Het
Slc24a1 C G 9: 64,928,404 E814Q unknown Het
Slc26a11 A T 11: 119,374,502 Q355L probably damaging Het
Sp100 C T 1: 85,707,239 L483F possibly damaging Het
St5 A G 7: 109,525,346 L1096P probably damaging Het
Ston1 T A 17: 88,635,901 M245K probably benign Het
Swap70 T A 7: 110,274,772 D442E probably benign Het
Syne2 T A 12: 76,046,186 V450D possibly damaging Het
Tbck T A 3: 132,752,563 N651K probably damaging Het
Timd4 A T 11: 46,817,758 T204S probably benign Het
Tmem102 A G 11: 69,804,885 L87P probably damaging Het
Tmem55a T A 4: 14,912,477 Y195* probably null Het
Tmprss11e T A 5: 86,709,480 T325S probably benign Het
Trpm1 G A 7: 64,240,582 V978M probably damaging Het
Wdr35 G A 12: 9,005,773 V482I probably benign Het
Wdr63 T C 3: 146,055,618 D661G probably benign Het
Zer1 T C 2: 30,101,484 probably null Het
Zfp503 T C 14: 21,986,011 D279G probably benign Het
Zfp870 A T 17: 32,883,762 C198S possibly damaging Het
Zfyve26 C T 12: 79,287,807 E146K probably benign Het
Zkscan6 T C 11: 65,828,531 V459A probably damaging Het
Other mutations in Wdr12
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01613:Wdr12 APN 1 60080559 missense probably damaging 1.00
R0313:Wdr12 UTSW 1 60082579 missense possibly damaging 0.92
R0684:Wdr12 UTSW 1 60089366 splice site probably benign
R1157:Wdr12 UTSW 1 60078230 missense probably damaging 1.00
R1411:Wdr12 UTSW 1 60088072 missense probably benign 0.01
R1539:Wdr12 UTSW 1 60083848 splice site probably null
R2075:Wdr12 UTSW 1 60091063 missense possibly damaging 0.77
R3113:Wdr12 UTSW 1 60087062 missense probably benign 0.01
R4533:Wdr12 UTSW 1 60078195 missense probably benign 0.05
R5153:Wdr12 UTSW 1 60094511 missense probably benign 0.08
R5196:Wdr12 UTSW 1 60087084 missense probably damaging 1.00
R6603:Wdr12 UTSW 1 60082624 missense probably damaging 1.00
R7310:Wdr12 UTSW 1 60082575 nonsense probably null
R7621:Wdr12 UTSW 1 60097589 start gained probably benign
R7805:Wdr12 UTSW 1 60097594 start gained probably benign
R7846:Wdr12 UTSW 1 60082066 missense probably damaging 1.00
R8008:Wdr12 UTSW 1 60089335 nonsense probably null
R8781:Wdr12 UTSW 1 60087141 missense probably damaging 1.00
Z1176:Wdr12 UTSW 1 60082564 missense possibly damaging 0.92
Predicted Primers PCR Primer
(F):5'- ACAGGCTACATGCTGTATTGAA -3'
(R):5'- TTGGGTCCTGAACTTCCACC -3'

Sequencing Primer
(F):5'- CAGGCTACATGCTGTATTGAAAAACC -3'
(R):5'- GTCTTGCATGAAGTACCC -3'
Posted On2019-10-07