Incidental Mutation 'R5196:Wdr12'
ID400190
Institutional Source Beutler Lab
Gene Symbol Wdr12
Ensembl Gene ENSMUSG00000026019
Gene NameWD repeat domain 12
SynonymsYtm1p, 4933402C23Rik, Ytm1
MMRRC Submission 042772-MU
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R5196 (G1)
Quality Score225
Status Validated
Chromosome1
Chromosomal Location60069785-60098645 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 60087084 bp
ZygosityHeterozygous
Amino Acid Change Serine to Glycine at position 191 (S191G)
Ref Sequence ENSEMBL: ENSMUSP00000113148 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000027173] [ENSMUST00000117438] [ENSMUST00000122038] [ENSMUST00000141417] [ENSMUST00000143342]
Predicted Effect probably damaging
Transcript: ENSMUST00000027173
AA Change: S191G

PolyPhen 2 Score 0.997 (Sensitivity: 0.41; Specificity: 0.98)
SMART Domains Protein: ENSMUSP00000027173
Gene: ENSMUSG00000026019
AA Change: S191G

DomainStartEndE-ValueType
Pfam:NLE 3 70 1.4e-20 PFAM
low complexity region 78 87 N/A INTRINSIC
WD40 91 127 5.97e-1 SMART
WD40 129 171 5.77e-5 SMART
WD40 178 217 2.04e-5 SMART
WD40 246 284 1.41e-8 SMART
WD40 287 325 2.69e-5 SMART
WD40 331 371 4.34e-9 SMART
WD40 375 413 3e-3 SMART
Predicted Effect probably damaging
Transcript: ENSMUST00000117438
AA Change: S191G

PolyPhen 2 Score 0.997 (Sensitivity: 0.41; Specificity: 0.98)
SMART Domains Protein: ENSMUSP00000113494
Gene: ENSMUSG00000026019
AA Change: S191G

DomainStartEndE-ValueType
Pfam:NLE 4 70 2e-19 PFAM
low complexity region 78 87 N/A INTRINSIC
WD40 91 127 5.97e-1 SMART
WD40 129 171 5.77e-5 SMART
WD40 178 217 2.04e-5 SMART
WD40 246 284 1.41e-8 SMART
WD40 287 325 2.69e-5 SMART
WD40 331 371 4.34e-9 SMART
WD40 375 413 3e-3 SMART
Predicted Effect probably damaging
Transcript: ENSMUST00000122038
AA Change: S191G

PolyPhen 2 Score 0.997 (Sensitivity: 0.41; Specificity: 0.98)
SMART Domains Protein: ENSMUSP00000113148
Gene: ENSMUSG00000026019
AA Change: S191G

DomainStartEndE-ValueType
Pfam:NLE 3 70 1.4e-20 PFAM
low complexity region 78 87 N/A INTRINSIC
WD40 91 127 5.97e-1 SMART
WD40 129 171 5.77e-5 SMART
WD40 178 217 2.04e-5 SMART
WD40 246 284 1.41e-8 SMART
WD40 287 325 2.69e-5 SMART
WD40 331 371 4.34e-9 SMART
WD40 375 413 3e-3 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000136461
Predicted Effect probably benign
Transcript: ENSMUST00000141417
SMART Domains Protein: ENSMUSP00000117747
Gene: ENSMUSG00000026019

DomainStartEndE-ValueType
Pfam:NLE 3 70 3.2e-22 PFAM
low complexity region 78 87 N/A INTRINSIC
WD40 91 127 5.97e-1 SMART
Blast:WD40 129 151 4e-7 BLAST
Predicted Effect probably benign
Transcript: ENSMUST00000143342
SMART Domains Protein: ENSMUSP00000117391
Gene: ENSMUSG00000026019

DomainStartEndE-ValueType
Pfam:NLE 3 70 3.2e-22 PFAM
low complexity region 78 87 N/A INTRINSIC
WD40 91 127 5.97e-1 SMART
Blast:WD40 129 151 4e-7 BLAST
Predicted Effect noncoding transcript
Transcript: ENSMUST00000147413
Meta Mutation Damage Score 0.1775 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.5%
  • 10x: 96.9%
  • 20x: 94.3%
Validation Efficiency 100% (62/62)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of the WD repeat protein family. WD repeats are minimally conserved regions of approximately 40 amino acids typically bracketed by gly-his and trp-asp (GH-WD), which may facilitate formation of heterotrimeric or multiprotein complexes. Members of this family are involved in a variety of cellular processes, including cell cycle progression, signal transduction, apoptosis, and gene regulation. This protein is highly similar to the mouse WD repeat domain 12 protein at the amino acid level. The protein encoded by this gene is a component of a nucleolar protein complex that affects maturation of the large ribosomal subunit.[provided by RefSeq, Dec 2008]
Allele List at MGI
Other mutations in this stock
Total: 52 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700001O22Rik T C 2: 30,796,438 T281A possibly damaging Het
4930503B20Rik A G 3: 146,646,263 probably benign Het
6330409D20Rik T A 2: 32,740,540 probably benign Het
Afg3l2 G T 18: 67,421,259 L458M probably damaging Het
Amigo2 A G 15: 97,246,061 F160S probably damaging Het
Arcn1 A T 9: 44,760,027 L68M probably damaging Het
Arhgef25 A G 10: 127,185,109 S303P probably damaging Het
Asph A T 4: 9,607,830 S163T probably damaging Het
BC003331 T A 1: 150,382,389 D165V probably damaging Het
Birc6 T C 17: 74,606,141 probably benign Het
Ccm2 G A 11: 6,561,181 probably benign Het
Cdc42bpa T C 1: 180,072,413 V431A probably benign Het
Cdh7 T A 1: 110,138,000 M668K probably damaging Het
Cfap43 A T 19: 47,825,925 W157R probably damaging Het
Chrm5 T C 2: 112,480,384 Y129C probably damaging Het
Chrna5 A G 9: 55,006,519 I421V possibly damaging Het
Clk1 T A 1: 58,414,613 T301S probably benign Het
Col6a3 G T 1: 90,816,538 probably null Het
Eml2 G A 7: 19,201,163 V432I probably damaging Het
Fam198a T G 9: 121,965,661 S294A probably benign Het
Fbxw19 T C 9: 109,484,428 Y234C probably benign Het
Fgd4 T A 16: 16,484,142 N183I probably benign Het
Fnip2 T C 3: 79,572,538 probably benign Het
Gm9847 T A 12: 14,495,015 noncoding transcript Het
H2-T23 A G 17: 36,032,607 probably null Het
Hdlbp T C 1: 93,420,193 E613G probably damaging Het
Kat6a G A 8: 22,911,713 R366H probably damaging Het
Kctd4 A G 14: 75,962,687 T33A probably benign Het
Klrb1c T A 6: 128,780,299 S268C probably benign Het
Lgr6 C T 1: 134,994,010 A199T probably damaging Het
Lrrfip1 A G 1: 91,114,608 E245G probably damaging Het
Mast3 A T 8: 70,788,245 I220N probably damaging Het
Mfap3 A G 11: 57,529,813 T207A probably damaging Het
Mtdh G T 15: 34,118,004 K75N probably damaging Het
Mybpc1 A G 10: 88,536,351 Y806H probably damaging Het
Ntng1 T C 3: 109,934,983 D158G probably damaging Het
Olfr1176 A G 2: 88,339,748 Y61C possibly damaging Het
Olfr812 T A 10: 129,842,781 D87V possibly damaging Het
Pask A G 1: 93,310,083 probably benign Het
Pif1 G T 9: 65,588,092 A95S probably benign Het
Plppr2 T C 9: 21,941,132 F104S probably damaging Het
Prmt9 G A 8: 77,564,997 V333M probably benign Het
Pten A T 19: 32,815,497 M239L probably benign Het
Rb1cc1 A G 1: 6,234,230 D67G probably damaging Het
Reg2 T A 6: 78,405,547 L12* probably null Het
Rufy4 T C 1: 74,147,663 C537R probably damaging Het
Slc5a7 C A 17: 54,281,722 probably null Het
Tcaf3 G T 6: 42,593,715 R368S probably benign Het
Tfcp2 A G 15: 100,520,714 V189A probably damaging Het
Uhrf1bp1 A G 17: 27,856,763 I5V probably benign Het
Zfp536 G A 7: 37,480,760 R807W probably damaging Het
Zfp647 G A 15: 76,912,085 P125L probably damaging Het
Other mutations in Wdr12
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01613:Wdr12 APN 1 60080559 missense probably damaging 1.00
R0313:Wdr12 UTSW 1 60082579 missense possibly damaging 0.92
R0684:Wdr12 UTSW 1 60089366 splice site probably benign
R1157:Wdr12 UTSW 1 60078230 missense probably damaging 1.00
R1411:Wdr12 UTSW 1 60088072 missense probably benign 0.01
R1539:Wdr12 UTSW 1 60083848 splice site probably null
R2075:Wdr12 UTSW 1 60091063 missense possibly damaging 0.77
R3113:Wdr12 UTSW 1 60087062 missense probably benign 0.01
R4533:Wdr12 UTSW 1 60078195 missense probably benign 0.05
R5153:Wdr12 UTSW 1 60094511 missense probably benign 0.08
R6603:Wdr12 UTSW 1 60082624 missense probably damaging 1.00
R7310:Wdr12 UTSW 1 60082575 nonsense probably null
R7466:Wdr12 UTSW 1 60094511 missense probably benign 0.08
R7621:Wdr12 UTSW 1 60097589 start gained probably benign
R7805:Wdr12 UTSW 1 60097594 start gained probably benign
R7846:Wdr12 UTSW 1 60082066 missense probably damaging 1.00
R7929:Wdr12 UTSW 1 60082066 missense probably damaging 1.00
R8008:Wdr12 UTSW 1 60089335 nonsense probably null
Z1176:Wdr12 UTSW 1 60082564 missense possibly damaging 0.92
Predicted Primers PCR Primer
(F):5'- CACTGACTGAAGAACTAAGTCAAG -3'
(R):5'- ACACTCACGAGAAAGCTGAGTG -3'

Sequencing Primer
(F):5'- AACTAAGTCAAGTAACTCTCTCTCTC -3'
(R):5'- CTCACGAGAAAGCTGAGTGATAAAG -3'
Posted On2016-07-06