Incidental Mutation 'R7541:Dbnl'
ID583901
Institutional Source Beutler Lab
Gene Symbol Dbnl
Ensembl Gene ENSMUSG00000020476
Gene Namedrebrin-like
SynonymsmAbp1, ABP1, SH3P7
MMRRC Submission
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.175) question?
Stock #R7541 (G1)
Quality Score225.009
Status Validated
Chromosome11
Chromosomal Location5788488-5800962 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to G at 5795486 bp
ZygosityHeterozygous
Amino Acid Change Aspartic acid to Glutamic Acid at position 122 (D122E)
Ref Sequence ENSEMBL: ENSMUSP00000020769 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000020769] [ENSMUST00000102928] [ENSMUST00000109845]
Predicted Effect probably damaging
Transcript: ENSMUST00000020769
AA Change: D122E

PolyPhen 2 Score 0.993 (Sensitivity: 0.70; Specificity: 0.97)
SMART Domains Protein: ENSMUSP00000020769
Gene: ENSMUSG00000020476
AA Change: D122E

DomainStartEndE-ValueType
ADF 7 133 2.39e-31 SMART
coiled coil region 180 233 N/A INTRINSIC
low complexity region 334 345 N/A INTRINSIC
SH3 380 436 1.62e-16 SMART
Predicted Effect probably damaging
Transcript: ENSMUST00000102928
AA Change: D122E

PolyPhen 2 Score 0.991 (Sensitivity: 0.71; Specificity: 0.97)
SMART Domains Protein: ENSMUSP00000099992
Gene: ENSMUSG00000020476
AA Change: D122E

DomainStartEndE-ValueType
ADF 7 133 2.39e-31 SMART
coiled coil region 180 233 N/A INTRINSIC
low complexity region 331 342 N/A INTRINSIC
SH3 377 433 1.62e-16 SMART
Predicted Effect probably damaging
Transcript: ENSMUST00000109845
AA Change: D122E

PolyPhen 2 Score 0.984 (Sensitivity: 0.74; Specificity: 0.96)
SMART Domains Protein: ENSMUSP00000105471
Gene: ENSMUSG00000020476
AA Change: D122E

DomainStartEndE-ValueType
ADF 7 133 2.39e-31 SMART
coiled coil region 180 233 N/A INTRINSIC
low complexity region 330 341 N/A INTRINSIC
SH3 376 432 1.62e-16 SMART
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 100.0%
  • 10x: 99.7%
  • 20x: 99.2%
Validation Efficiency 96% (51/53)
MGI Phenotype PHENOTYPE: Targeted mutation causes abnormal structure and function in organs including the spleen, heart and lungs. Vesicle transport is impaired in the brain and neurological impairment is observed. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 53 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700020D05Rik G A 19: 5,503,411 P114L probably benign Het
4930539E08Rik G A 17: 28,905,324 R335W probably damaging Het
9530053A07Rik T A 7: 28,144,256 C856* probably null Het
Acss2 G A 2: 155,574,690 probably null Het
Adamts10 G A 17: 33,531,616 R210H probably benign Het
Als2 T C 1: 59,167,616 probably null Het
Aplp2 A T 9: 31,152,356 M652K possibly damaging Het
Atrn A G 2: 130,961,571 I560M possibly damaging Het
Bicc1 T C 10: 70,946,604 D602G possibly damaging Het
Cdh4 A G 2: 179,444,810 probably null Het
Clasp1 T A 1: 118,542,997 probably null Het
Col6a6 A G 9: 105,767,324 I1255T probably damaging Het
Comp G T 8: 70,381,350 V672L probably damaging Het
Dgkz G A 2: 91,942,675 R346C probably damaging Het
Dnhd1 C T 7: 105,678,309 R54C probably damaging Het
Elmo3 T C 8: 105,306,714 I121T probably damaging Het
Fam184b A G 5: 45,542,232 L614P probably damaging Het
Fbxo18 T C 2: 11,749,537 R797G probably benign Het
Gata6 A G 18: 11,059,108 T392A probably damaging Het
Gm17783 T A 16: 45,528,492 T106S possibly damaging Het
Gm21731 A T 13: 120,240,979 M104L probably benign Het
Gm29609 A G 5: 31,154,232 F855S probably benign Het
Gm3424 T C 14: 5,829,330 N88D possibly damaging Het
Gnas T A 2: 174,298,099 S80T unknown Het
Hsd17b14 C A 7: 45,566,146 P190Q probably damaging Het
Iqch C T 9: 63,445,521 V955I possibly damaging Het
Kcnt2 T C 1: 140,376,384 V164A probably benign Het
Krt87 A G 15: 101,438,634 L46P probably damaging Het
Lef1 A G 3: 131,191,099 M237V probably benign Het
Lmbr1l A T 15: 98,909,386 probably null Het
Lrrc49 T C 9: 60,610,403 I408V probably damaging Het
Luc7l3 T C 11: 94,295,965 S365G unknown Het
March2 A T 17: 33,703,058 C109* probably null Het
Metrnl T A 11: 121,715,970 C284S probably damaging Het
Mmachc G A 4: 116,705,885 T91I probably benign Het
Mrps7 T G 11: 115,606,870 M187R probably damaging Het
Ncapd3 A G 9: 27,067,040 E845G probably damaging Het
Olfr1393 T A 11: 49,280,333 F62I probably damaging Het
Olfr272 A T 4: 52,911,376 D139E probably benign Het
Ooep T A 9: 78,378,065 T90S possibly damaging Het
Pcdhb18 A T 18: 37,491,609 D664V probably damaging Het
Pigz T C 16: 31,945,131 S336P probably benign Het
Pou2f2 A T 7: 25,116,128 D71E probably benign Het
Reep6 G T 10: 80,335,199 R303L possibly damaging Het
Rmdn2 A T 17: 79,627,868 S137C Het
Rnf220 A T 4: 117,489,930 L95H probably damaging Het
Rsf1 CGGCGGCGG CGGCGGCGGGGGCGGCGG 7: 97,579,911 probably benign Het
Stxbp1 A T 2: 32,818,505 S83T probably damaging Het
Trappc11 T C 8: 47,505,582 probably null Het
Ttn G T 2: 76,791,301 D15598E probably damaging Het
Vav2 T A 2: 27,275,002 R645W probably damaging Het
Vmn1r169 T A 7: 23,577,987 V268D probably benign Het
Zp2 A T 7: 120,136,056 C365S probably damaging Het
Other mutations in Dbnl
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00902:Dbnl APN 11 5798105 missense probably benign
IGL01101:Dbnl APN 11 5793722 missense possibly damaging 0.94
IGL01596:Dbnl APN 11 5798279 missense probably damaging 1.00
IGL01924:Dbnl APN 11 5797142 missense probably damaging 1.00
IGL02331:Dbnl APN 11 5799997 makesense probably null
R0433:Dbnl UTSW 11 5796825 critical splice donor site probably null
R0646:Dbnl UTSW 11 5795441 splice site probably benign
R0656:Dbnl UTSW 11 5797321 missense probably benign
R1037:Dbnl UTSW 11 5796807 missense probably damaging 1.00
R1691:Dbnl UTSW 11 5797174 missense probably null 0.12
R1883:Dbnl UTSW 11 5799247 missense probably benign 0.01
R1884:Dbnl UTSW 11 5799247 missense probably benign 0.01
R7033:Dbnl UTSW 11 5798102 missense probably benign 0.44
R7702:Dbnl UTSW 11 5798048 missense probably benign
R7761:Dbnl UTSW 11 5788597 missense probably benign 0.33
R7904:Dbnl UTSW 11 5791779 splice site probably null
R8725:Dbnl UTSW 11 5788582 missense probably benign 0.07
R8727:Dbnl UTSW 11 5788582 missense probably benign 0.07
R8837:Dbnl UTSW 11 5791839 missense possibly damaging 0.95
Z1088:Dbnl UTSW 11 5796797 nonsense probably null
Predicted Primers PCR Primer
(F):5'- AACTCTAAGGTCCACAGCTGG -3'
(R):5'- TCTAAAGACCCCAAGCAGGAGG -3'

Sequencing Primer
(F):5'- TCCACAGCTGGGGAGAG -3'
(R):5'- GGAATGTAGTTACCTCGACATTAGG -3'
Posted On2019-10-17