Incidental Mutation 'R7562:Sept9'
ID 585208
Institutional Source Beutler Lab
Gene Symbol Sept9
Ensembl Gene ENSMUSG00000059248
Gene Name septin 9
Synonyms PNUTL4, Msf, Sint1, SL3-3 integration site 1, MSF1
MMRRC Submission
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock # R7562 (G1)
Quality Score 225.009
Status Not validated
Chromosome 11
Chromosomal Location 117199661-117362325 bp(+) (GRCm38)
Type of Mutation critical splice donor site (2 bp from exon)
DNA Base Change (assembly) T to C at 117326511 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change
Ref Sequence ENSEMBL: ENSMUSP00000120065 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000019038] [ENSMUST00000093907] [ENSMUST00000106354] [ENSMUST00000127383] [ENSMUST00000127383] [ENSMUST00000153668]
AlphaFold Q80UG5
Predicted Effect probably benign
Transcript: ENSMUST00000019038
SMART Domains Protein: ENSMUSP00000019038
Gene: ENSMUSG00000059248

DomainStartEndE-ValueType
Pfam:DUF258 265 379 5.3e-8 PFAM
Pfam:Septin 286 565 1.2e-112 PFAM
Pfam:GTP_EFTU 289 365 1.5e-5 PFAM
Pfam:AIG1 290 379 3.1e-7 PFAM
Pfam:MMR_HSR1 291 481 1.1e-9 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000093907
SMART Domains Protein: ENSMUSP00000091435
Gene: ENSMUSG00000059248

DomainStartEndE-ValueType
Pfam:Septin 293 572 1.6e-112 PFAM
Pfam:MMR_HSR1 298 444 3e-10 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000106354
SMART Domains Protein: ENSMUSP00000101961
Gene: ENSMUSG00000059248

DomainStartEndE-ValueType
Pfam:DUF258 254 368 4.2e-8 PFAM
Pfam:Septin 275 554 3.4e-113 PFAM
Pfam:GTP_EFTU 278 354 3.7e-6 PFAM
Pfam:AIG1 279 368 1.9e-7 PFAM
Pfam:MMR_HSR1 280 378 7.6e-10 PFAM
Predicted Effect probably null
Transcript: ENSMUST00000127383
SMART Domains Protein: ENSMUSP00000120065
Gene: ENSMUSG00000059248

DomainStartEndE-ValueType
Pfam:DUF258 43 158 1.2e-8 PFAM
Pfam:Septin 63 242 6.2e-79 PFAM
Pfam:GTP_EFTU 66 142 9.2e-7 PFAM
Pfam:AIG1 67 161 4.2e-8 PFAM
Pfam:MMR_HSR1 68 222 8.9e-11 PFAM
Predicted Effect probably null
Transcript: ENSMUST00000127383
SMART Domains Protein: ENSMUSP00000120065
Gene: ENSMUSG00000059248

DomainStartEndE-ValueType
Pfam:DUF258 43 158 1.2e-8 PFAM
Pfam:Septin 63 242 6.2e-79 PFAM
Pfam:GTP_EFTU 66 142 9.2e-7 PFAM
Pfam:AIG1 67 161 4.2e-8 PFAM
Pfam:MMR_HSR1 68 222 8.9e-11 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000153668
SMART Domains Protein: ENSMUSP00000120382
Gene: ENSMUSG00000059248

DomainStartEndE-ValueType
Pfam:DUF258 16 74 1.2e-7 PFAM
Pfam:Septin 44 74 4e-12 PFAM
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.7%
  • 20x: 99.1%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene is a member of the septin family involved in cytokinesis and cell cycle control. This gene is a candidate for the ovarian tumor suppressor gene. Mutations in this gene cause hereditary neuralgic amyotrophy, also known as neuritis with brachial predilection. A chromosomal translocation involving this gene on chromosome 17 and the MLL gene on chromosome 11 results in acute myelomonocytic leukemia. Multiple alternatively spliced transcript variants encoding different isoforms have been described.[provided by RefSeq, Mar 2009]
PHENOTYPE: Mice homozygous for a targeted allele exhibit embryonic lethality around E10 with generalized apoptotic degeneration. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 70 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2310007B03Rik C A 1: 93,159,967 V55F probably damaging Het
4930539E08Rik T C 17: 28,909,804 D45G probably benign Het
5430419D17Rik T A 7: 131,302,697 D2381E unknown Het
Ablim2 C T 5: 35,873,219 T544M probably benign Het
Adamts12 A G 15: 11,270,611 R651G probably benign Het
Adck1 G A 12: 88,368,433 D30N possibly damaging Het
Alcam T A 16: 52,268,823 I505F probably benign Het
Alms1 T C 6: 85,620,412 L740P probably damaging Het
Ankib1 C T 5: 3,747,021 D264N probably null Het
Arid2 T G 15: 96,401,968 H1787Q probably damaging Het
Asf1a C T 10: 53,606,187 R102* probably null Het
Atp2b1 C A 10: 99,022,805 probably null Het
Bdp1 T C 13: 100,025,541 D2291G probably benign Het
Brinp3 C G 1: 146,902,010 L732V possibly damaging Het
Catsperg2 A G 7: 29,697,719 F1120L probably benign Het
Ccdc80 C T 16: 45,122,903 A792V probably damaging Het
Cenpe C T 3: 135,248,634 R1751W probably damaging Het
Cenpm T C 15: 82,241,361 I66V probably benign Het
Clcn4 A G 7: 7,295,082 W103R possibly damaging Het
Cntn2 T C 1: 132,526,317 D317G possibly damaging Het
Cwf19l1 G A 19: 44,129,241 T154M probably damaging Het
Cyp2a4 T A 7: 26,312,896 M368K possibly damaging Het
Dars A G 1: 128,367,026 S413P possibly damaging Het
Dscc1 A G 15: 55,084,185 Y200H probably benign Het
Dsn1 A T 2: 157,000,872 D183E probably damaging Het
Etfdh T C 3: 79,623,579 Y45C probably damaging Het
Fam71f1 T C 6: 29,323,834 V186A probably damaging Het
Fancc A T 13: 63,403,053 probably null Het
Fbxo34 T A 14: 47,529,678 M216K probably benign Het
Fer1l6 T G 15: 58,560,482 S293A probably benign Het
Foxn1 T A 11: 78,371,132 E137V probably damaging Het
Fshr A C 17: 88,988,497 F261V probably damaging Het
Gabrb3 C T 7: 57,812,178 R153* probably null Het
Gps2 C A 11: 69,916,482 N321K probably benign Het
Hdgf T C 3: 87,906,686 M20T possibly damaging Het
Igdcc4 G T 9: 65,124,024 A415S probably damaging Het
Kif26b A G 1: 178,914,976 E879G probably damaging Het
Krt13 T C 11: 100,119,336 Y273C probably damaging Het
Mag A G 7: 30,909,134 V185A possibly damaging Het
Map3k21 C T 8: 125,938,800 T576M probably damaging Het
Mtrr A G 13: 68,566,217 F468L probably damaging Het
Myb C T 10: 21,141,754 probably null Het
Naip5 T C 13: 100,219,696 Q1137R probably benign Het
Naip5 G T 13: 100,219,697 Q1137K not run Het
Nckap5l A T 15: 99,423,285 probably null Het
Nop9 C T 14: 55,749,352 R240W probably benign Het
Notch2 T C 3: 98,113,114 L775P probably damaging Het
Olfr1221 C T 2: 89,112,285 V76I probably benign Het
Olfr19 T C 16: 16,673,715 N89D probably benign Het
Olfr25 A G 9: 38,329,943 T116A probably damaging Het
Olfr545 T A 7: 102,494,020 I252F possibly damaging Het
Olfr60 T C 7: 140,345,230 Y253C probably damaging Het
Oxa1l T A 14: 54,363,477 W136R probably damaging Het
Palm3 T A 8: 84,021,507 V7E possibly damaging Het
Pkhd1l1 C G 15: 44,514,930 R1027G possibly damaging Het
Prickle2 A T 6: 92,375,948 *902K probably null Het
Rassf7 C T 7: 141,217,188 R105* probably null Het
Soga1 A C 2: 157,053,589 L332R probably damaging Het
Sorbs3 T C 14: 70,207,527 N34S probably benign Het
Sos2 T C 12: 69,635,638 T269A probably benign Het
Spata20 T G 11: 94,482,553 K497N probably benign Het
Speg A G 1: 75,431,279 D3206G probably damaging Het
Tenm4 A G 7: 96,888,814 T1865A probably damaging Het
Tmc5 A T 7: 118,623,326 Y83F probably benign Het
Tmem175 T A 5: 108,641,849 D103E probably damaging Het
Top2b A C 14: 16,412,946 M952L probably benign Het
Vmn2r6 T C 3: 64,556,520 I298V probably benign Het
Vmn2r69 T C 7: 85,407,212 I573V probably benign Het
Vmn2r93 A G 17: 18,298,469 I63M probably benign Het
Zfp568 G A 7: 30,023,256 R542H probably benign Het
Other mutations in Sept9
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00157:Sept9 APN 11 117352184 missense probably damaging 1.00
IGL00230:Sept9 APN 11 117354804 unclassified probably benign
IGL01520:Sept9 APN 11 117352643 missense probably damaging 1.00
IGL01905:Sept9 APN 11 117218889 missense probably benign 0.07
IGL02502:Sept9 APN 11 117290662 missense probably damaging 1.00
R0325:Sept9 UTSW 11 117356632 missense probably damaging 0.99
R0825:Sept9 UTSW 11 117359460 missense probably damaging 1.00
R0845:Sept9 UTSW 11 117356325 unclassified probably benign
R1581:Sept9 UTSW 11 117290595 missense probably damaging 1.00
R1763:Sept9 UTSW 11 117290428 missense probably benign 0.04
R1848:Sept9 UTSW 11 117353083 unclassified probably benign
R2039:Sept9 UTSW 11 117351617 missense probably damaging 1.00
R2409:Sept9 UTSW 11 117360461 missense probably damaging 1.00
R2763:Sept9 UTSW 11 117326501 missense probably benign 0.05
R3545:Sept9 UTSW 11 117352673 missense probably damaging 1.00
R4062:Sept9 UTSW 11 117352265 missense probably damaging 1.00
R4601:Sept9 UTSW 11 117360484 missense probably damaging 1.00
R5139:Sept9 UTSW 11 117356685 missense possibly damaging 0.80
R5759:Sept9 UTSW 11 117352268 missense probably benign 0.15
R6062:Sept9 UTSW 11 117290800 missense possibly damaging 0.89
R6134:Sept9 UTSW 11 117352161 missense probably damaging 1.00
R6509:Sept9 UTSW 11 117290427 missense probably benign
R7573:Sept9 UTSW 11 117199745 start gained probably benign
R7592:Sept9 UTSW 11 117290662 missense probably damaging 1.00
R7810:Sept9 UTSW 11 117359438 nonsense probably null
R8200:Sept9 UTSW 11 117232716 missense probably benign 0.01
R9118:Sept9 UTSW 11 117266572 missense probably benign
R9131:Sept9 UTSW 11 117290634 missense probably damaging 1.00
R9220:Sept9 UTSW 11 117351570 missense probably benign 0.05
R9241:Sept9 UTSW 11 117218898 missense probably benign 0.00
R9661:Sept9 UTSW 11 117354925 missense possibly damaging 0.91
R9735:Sept9 UTSW 11 117354854 missense probably damaging 0.99
Predicted Primers PCR Primer
(F):5'- GAACCCACTGGAGAGATGGATC -3'
(R):5'- ACAGTGGCTTGCAATGGATTC -3'

Sequencing Primer
(F):5'- CCACTGGAGAGATGGATCAAAGC -3'
(R):5'- AGGTGAACTGATGCCAGCC -3'
Posted On 2019-10-17