Incidental Mutation 'R7562:Top2b'
ID 585215
Institutional Source Beutler Lab
Gene Symbol Top2b
Ensembl Gene ENSMUSG00000017485
Gene Name topoisomerase (DNA) II beta
Synonyms Top-2, D230016L12Rik
MMRRC Submission 045627-MU
Accession Numbers
Essential gene? Probably essential (E-score: 0.929) question?
Stock # R7562 (G1)
Quality Score 225.009
Status Not validated
Chromosome 14
Chromosomal Location 6038976-6104585 bp(-) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) A to C at 16412946 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change Methionine to Leucine at position 952 (M952L)
Ref Sequence ENSEMBL: ENSMUSP00000017629 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000017629] [ENSMUST00000161693]
AlphaFold Q64511
Predicted Effect probably benign
Transcript: ENSMUST00000017629
AA Change: M952L

PolyPhen 2 Score 0.042 (Sensitivity: 0.94; Specificity: 0.83)
SMART Domains Protein: ENSMUSP00000017629
Gene: ENSMUSG00000017485
AA Change: M952L

DomainStartEndE-ValueType
Blast:TOP2c 32 70 7e-10 BLAST
HATPase_c 85 234 1.91e-2 SMART
TOP2c 89 679 N/A SMART
TOP4c 702 1175 2.55e-230 SMART
low complexity region 1201 1215 N/A INTRINSIC
low complexity region 1287 1299 N/A INTRINSIC
low complexity region 1324 1336 N/A INTRINSIC
low complexity region 1360 1382 N/A INTRINSIC
Pfam:DTHCT 1495 1597 4.6e-31 PFAM
Predicted Effect
SMART Domains Protein: ENSMUSP00000124889
Gene: ENSMUSG00000017485
AA Change: M94L

DomainStartEndE-ValueType
TOP4c 2 222 3.97e-12 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000161693
SMART Domains Protein: ENSMUSP00000123992
Gene: ENSMUSG00000017485

DomainStartEndE-ValueType
Pfam:DNA_topoisoIV 1 117 1.2e-12 PFAM
low complexity region 161 173 N/A INTRINSIC
low complexity region 198 210 N/A INTRINSIC
low complexity region 234 256 N/A INTRINSIC
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.7%
  • 20x: 99.1%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a DNA topoisomerase, an enzyme that controls and alters the topologic states of DNA during transcription. This nuclear enzyme is involved in processes such as chromosome condensation, chromatid separation, and the relief of torsional stress that occurs during DNA transcription and replication. It catalyzes the transient breaking and rejoining of two strands of duplex DNA which allows the strands to pass through one another, thus altering the topology of DNA. Two forms of this enzyme exist as likely products of a gene duplication event. The gene encoding this form, beta, is localized to chromosome 3 and the alpha form is localized to chromosome 17. The gene encoding this enzyme functions as the target for several anticancer agents and a variety of mutations in this gene have been associated with the development of drug resistance. Reduced activity of this enzyme may also play a role in ataxia-telangiectasia. Alternative splicing results in multiple transcript variants. [provided by RefSeq, Aug 2016]
PHENOTYPE: Homozygous null mice exhibit abnormal innervation. Offspring die shortly after birth due to respiratory failure. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 70 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Ablim2 C T 5: 36,030,563 (GRCm39) T544M probably benign Het
Adamts12 A G 15: 11,270,697 (GRCm39) R651G probably benign Het
Adck1 G A 12: 88,335,203 (GRCm39) D30N possibly damaging Het
Alcam T A 16: 52,089,186 (GRCm39) I505F probably benign Het
Alms1 T C 6: 85,597,394 (GRCm39) L740P probably damaging Het
Ankib1 C T 5: 3,797,021 (GRCm39) D264N probably null Het
Arid2 T G 15: 96,299,849 (GRCm39) H1787Q probably damaging Het
Asf1a C T 10: 53,482,283 (GRCm39) R102* probably null Het
Atp2b1 C A 10: 98,858,667 (GRCm39) probably null Het
Bdp1 T C 13: 100,162,049 (GRCm39) D2291G probably benign Het
Bnip5 T C 17: 29,128,778 (GRCm39) D45G probably benign Het
Brinp3 C G 1: 146,777,748 (GRCm39) L732V possibly damaging Het
Catsperg2 A G 7: 29,397,144 (GRCm39) F1120L probably benign Het
Ccdc80 C T 16: 44,943,266 (GRCm39) A792V probably damaging Het
Cdcp3 T A 7: 130,904,426 (GRCm39) D2381E unknown Het
Cenpe C T 3: 134,954,395 (GRCm39) R1751W probably damaging Het
Cenpm T C 15: 82,125,562 (GRCm39) I66V probably benign Het
Clcn4 A G 7: 7,298,081 (GRCm39) W103R possibly damaging Het
Cntn2 T C 1: 132,454,055 (GRCm39) D317G possibly damaging Het
Cwf19l1 G A 19: 44,117,680 (GRCm39) T154M probably damaging Het
Cyp2a4 T A 7: 26,012,321 (GRCm39) M368K possibly damaging Het
Dars1 A G 1: 128,294,763 (GRCm39) S413P possibly damaging Het
Dscc1 A G 15: 54,947,581 (GRCm39) Y200H probably benign Het
Dsn1 A T 2: 156,842,792 (GRCm39) D183E probably damaging Het
Etfdh T C 3: 79,530,886 (GRCm39) Y45C probably damaging Het
Fancc A T 13: 63,550,867 (GRCm39) probably null Het
Fbxo34 T A 14: 47,767,135 (GRCm39) M216K probably benign Het
Fer1l6 T G 15: 58,432,331 (GRCm39) S293A probably benign Het
Foxn1 T A 11: 78,261,958 (GRCm39) E137V probably damaging Het
Fshr A C 17: 89,295,925 (GRCm39) F261V probably damaging Het
Gabrb3 C T 7: 57,461,926 (GRCm39) R153* probably null Het
Garin1b T C 6: 29,323,833 (GRCm39) V186A probably damaging Het
Gps2 C A 11: 69,807,308 (GRCm39) N321K probably benign Het
Hdgf T C 3: 87,813,993 (GRCm39) M20T possibly damaging Het
Igdcc4 G T 9: 65,031,306 (GRCm39) A415S probably damaging Het
Kif26b A G 1: 178,742,541 (GRCm39) E879G probably damaging Het
Krt13 T C 11: 100,010,162 (GRCm39) Y273C probably damaging Het
Mab21l4 C A 1: 93,087,689 (GRCm39) V55F probably damaging Het
Mag A G 7: 30,608,559 (GRCm39) V185A possibly damaging Het
Map3k21 C T 8: 126,665,539 (GRCm39) T576M probably damaging Het
Mtcl2 A C 2: 156,895,509 (GRCm39) L332R probably damaging Het
Mtrr A G 13: 68,714,336 (GRCm39) F468L probably damaging Het
Myb C T 10: 21,017,653 (GRCm39) probably null Het
Naip5 T C 13: 100,356,204 (GRCm39) Q1137R probably benign Het
Naip5 G T 13: 100,356,205 (GRCm39) Q1137K not run Het
Nckap5l A T 15: 99,321,166 (GRCm39) probably null Het
Nop9 C T 14: 55,986,809 (GRCm39) R240W probably benign Het
Notch2 T C 3: 98,020,430 (GRCm39) L775P probably damaging Het
Or13a27 T C 7: 139,925,143 (GRCm39) Y253C probably damaging Het
Or4c116 C T 2: 88,942,629 (GRCm39) V76I probably benign Het
Or55b10 T A 7: 102,143,227 (GRCm39) I252F possibly damaging Het
Or7a40 T C 16: 16,491,579 (GRCm39) N89D probably benign Het
Or8c9 A G 9: 38,241,239 (GRCm39) T116A probably damaging Het
Oxa1l T A 14: 54,600,934 (GRCm39) W136R probably damaging Het
Palm3 T A 8: 84,748,136 (GRCm39) V7E possibly damaging Het
Pkhd1l1 C G 15: 44,378,326 (GRCm39) R1027G possibly damaging Het
Prickle2 A T 6: 92,352,929 (GRCm39) *902K probably null Het
Rassf7 C T 7: 140,797,101 (GRCm39) R105* probably null Het
Septin9 T C 11: 117,217,337 (GRCm39) probably null Het
Sorbs3 T C 14: 70,444,976 (GRCm39) N34S probably benign Het
Sos2 T C 12: 69,682,412 (GRCm39) T269A probably benign Het
Spata20 T G 11: 94,373,379 (GRCm39) K497N probably benign Het
Speg A G 1: 75,407,923 (GRCm39) D3206G probably damaging Het
Tenm4 A G 7: 96,538,021 (GRCm39) T1865A probably damaging Het
Tmc5 A T 7: 118,222,549 (GRCm39) Y83F probably benign Het
Tmem175 T A 5: 108,789,715 (GRCm39) D103E probably damaging Het
Vmn2r6 T C 3: 64,463,941 (GRCm39) I298V probably benign Het
Vmn2r69 T C 7: 85,056,420 (GRCm39) I573V probably benign Het
Vmn2r93 A G 17: 18,518,731 (GRCm39) I63M probably benign Het
Zfp568 G A 7: 29,722,681 (GRCm39) R542H probably benign Het
Other mutations in Top2b
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00430:Top2b APN 14 16,422,692 (GRCm38) missense probably benign 0.00
IGL00730:Top2b APN 14 16,389,831 (GRCm38) missense probably damaging 1.00
IGL00917:Top2b APN 14 16,407,354 (GRCm38) missense probably benign 0.05
IGL01959:Top2b APN 14 16,422,695 (GRCm38) missense probably benign 0.19
IGL02019:Top2b APN 14 16,409,965 (GRCm38) missense probably benign 0.44
IGL02119:Top2b APN 14 16,406,733 (GRCm38) missense probably damaging 1.00
IGL02136:Top2b APN 14 16,407,103 (GRCm38) unclassified probably benign
IGL02148:Top2b APN 14 16,400,488 (GRCm38) missense probably damaging 1.00
IGL02496:Top2b APN 14 16,387,335 (GRCm38) missense probably benign
IGL02503:Top2b APN 14 16,407,163 (GRCm38) missense possibly damaging 0.92
IGL02672:Top2b APN 14 16,409,166 (GRCm38) unclassified probably benign
IGL02721:Top2b APN 14 16,409,236 (GRCm38) missense probably damaging 1.00
IGL02886:Top2b APN 14 16,365,688 (GRCm38) missense possibly damaging 0.73
IGL03252:Top2b APN 14 16,393,163 (GRCm38) missense possibly damaging 0.60
PIT4434001:Top2b UTSW 14 16,423,780 (GRCm38) critical splice donor site probably null
R0092:Top2b UTSW 14 16,409,263 (GRCm38) missense probably damaging 1.00
R0201:Top2b UTSW 14 16,383,174 (GRCm38) missense probably damaging 1.00
R0390:Top2b UTSW 14 16,418,442 (GRCm38) missense probably benign 0.00
R0394:Top2b UTSW 14 16,413,556 (GRCm38) splice site probably null
R1159:Top2b UTSW 14 16,430,329 (GRCm38) missense possibly damaging 0.81
R1424:Top2b UTSW 14 16,383,177 (GRCm38) missense probably damaging 1.00
R1519:Top2b UTSW 14 16,408,953 (GRCm38) splice site probably null
R1561:Top2b UTSW 14 16,398,993 (GRCm38) missense possibly damaging 0.80
R1713:Top2b UTSW 14 16,409,823 (GRCm38) missense probably benign 0.05
R1987:Top2b UTSW 14 16,398,916 (GRCm38) missense probably damaging 0.99
R2219:Top2b UTSW 14 16,409,189 (GRCm38) missense probably damaging 1.00
R2287:Top2b UTSW 14 16,409,189 (GRCm38) missense probably damaging 1.00
R2422:Top2b UTSW 14 16,409,189 (GRCm38) missense probably damaging 1.00
R2679:Top2b UTSW 14 16,413,947 (GRCm38) missense probably damaging 1.00
R3687:Top2b UTSW 14 16,409,189 (GRCm38) missense probably damaging 1.00
R3707:Top2b UTSW 14 16,388,447 (GRCm38) missense probably damaging 1.00
R3810:Top2b UTSW 14 16,409,189 (GRCm38) missense probably damaging 1.00
R3812:Top2b UTSW 14 16,409,189 (GRCm38) missense probably damaging 1.00
R3815:Top2b UTSW 14 16,409,189 (GRCm38) missense probably damaging 1.00
R3816:Top2b UTSW 14 16,409,189 (GRCm38) missense probably damaging 1.00
R3818:Top2b UTSW 14 16,409,189 (GRCm38) missense probably damaging 1.00
R4023:Top2b UTSW 14 16,409,189 (GRCm38) missense probably damaging 1.00
R4025:Top2b UTSW 14 16,409,189 (GRCm38) missense probably damaging 1.00
R4026:Top2b UTSW 14 16,409,189 (GRCm38) missense probably damaging 1.00
R4133:Top2b UTSW 14 16,409,189 (GRCm38) missense probably damaging 1.00
R4157:Top2b UTSW 14 16,384,491 (GRCm38) missense probably benign 0.42
R4179:Top2b UTSW 14 16,409,189 (GRCm38) missense probably damaging 1.00
R4180:Top2b UTSW 14 16,409,189 (GRCm38) missense probably damaging 1.00
R4300:Top2b UTSW 14 16,409,189 (GRCm38) missense probably damaging 1.00
R4376:Top2b UTSW 14 16,409,189 (GRCm38) missense probably damaging 1.00
R4377:Top2b UTSW 14 16,409,189 (GRCm38) missense probably damaging 1.00
R4492:Top2b UTSW 14 16,409,189 (GRCm38) missense probably damaging 1.00
R4549:Top2b UTSW 14 16,409,189 (GRCm38) missense probably damaging 1.00
R4550:Top2b UTSW 14 16,409,189 (GRCm38) missense probably damaging 1.00
R4581:Top2b UTSW 14 16,409,189 (GRCm38) missense probably damaging 1.00
R4582:Top2b UTSW 14 16,409,189 (GRCm38) missense probably damaging 1.00
R4628:Top2b UTSW 14 16,409,189 (GRCm38) missense probably damaging 1.00
R4630:Top2b UTSW 14 16,409,189 (GRCm38) missense probably damaging 1.00
R4667:Top2b UTSW 14 16,409,189 (GRCm38) missense probably damaging 1.00
R4668:Top2b UTSW 14 16,409,189 (GRCm38) missense probably damaging 1.00
R4669:Top2b UTSW 14 16,409,189 (GRCm38) missense probably damaging 1.00
R4698:Top2b UTSW 14 16,387,331 (GRCm38) nonsense probably null
R4769:Top2b UTSW 14 16,398,991 (GRCm38) missense probably damaging 1.00
R4809:Top2b UTSW 14 16,383,125 (GRCm38) missense probably benign 0.06
R4899:Top2b UTSW 14 16,387,313 (GRCm38) missense probably damaging 1.00
R5035:Top2b UTSW 14 16,409,966 (GRCm38) missense probably benign 0.01
R5621:Top2b UTSW 14 16,387,280 (GRCm38) missense probably damaging 1.00
R5631:Top2b UTSW 14 16,409,882 (GRCm38) missense probably damaging 1.00
R5685:Top2b UTSW 14 16,413,666 (GRCm38) missense probably damaging 1.00
R5732:Top2b UTSW 14 16,400,106 (GRCm38) missense possibly damaging 0.92
R5939:Top2b UTSW 14 16,422,786 (GRCm38) missense probably damaging 0.96
R6007:Top2b UTSW 14 16,423,779 (GRCm38) critical splice donor site probably null
R6087:Top2b UTSW 14 16,409,864 (GRCm38) missense probably benign 0.14
R6144:Top2b UTSW 14 16,423,740 (GRCm38) missense possibly damaging 0.48
R6196:Top2b UTSW 14 16,409,189 (GRCm38) missense probably damaging 1.00
R6218:Top2b UTSW 14 16,409,189 (GRCm38) missense probably damaging 1.00
R6229:Top2b UTSW 14 16,409,838 (GRCm38) missense probably damaging 1.00
R6249:Top2b UTSW 14 16,399,006 (GRCm38) missense probably damaging 1.00
R6337:Top2b UTSW 14 16,399,026 (GRCm38) missense possibly damaging 0.77
R6353:Top2b UTSW 14 16,416,671 (GRCm38) missense probably damaging 1.00
R6512:Top2b UTSW 14 16,409,854 (GRCm38) missense possibly damaging 0.94
R6573:Top2b UTSW 14 16,398,991 (GRCm38) missense probably damaging 1.00
R6614:Top2b UTSW 14 16,407,142 (GRCm38) nonsense probably null
R6844:Top2b UTSW 14 16,429,383 (GRCm38) missense possibly damaging 0.94
R6848:Top2b UTSW 14 16,409,958 (GRCm38) missense possibly damaging 0.89
R6871:Top2b UTSW 14 16,409,189 (GRCm38) missense probably damaging 1.00
R6895:Top2b UTSW 14 16,413,604 (GRCm38) missense probably benign 0.06
R7162:Top2b UTSW 14 16,416,653 (GRCm38) missense probably benign 0.00
R7247:Top2b UTSW 14 16,416,962 (GRCm38) missense probably benign 0.08
R7250:Top2b UTSW 14 16,420,411 (GRCm38) missense probably benign
R7359:Top2b UTSW 14 16,407,376 (GRCm38) missense probably null 1.00
R7365:Top2b UTSW 14 16,416,649 (GRCm38) missense probably benign 0.04
R7493:Top2b UTSW 14 16,416,605 (GRCm38) missense probably benign 0.00
R7528:Top2b UTSW 14 16,395,427 (GRCm38) nonsense probably null
R7594:Top2b UTSW 14 16,428,587 (GRCm38) missense probably benign
R7670:Top2b UTSW 14 16,416,620 (GRCm38) missense possibly damaging 0.61
R7894:Top2b UTSW 14 16,413,081 (GRCm38) missense possibly damaging 0.68
R8031:Top2b UTSW 14 16,412,986 (GRCm38) missense probably damaging 0.98
R8150:Top2b UTSW 14 16,393,291 (GRCm38) missense probably damaging 0.99
R8214:Top2b UTSW 14 16,383,177 (GRCm38) missense probably damaging 1.00
R8299:Top2b UTSW 14 16,386,123 (GRCm38) missense possibly damaging 0.68
R8977:Top2b UTSW 14 16,393,239 (GRCm38) missense probably benign 0.36
R9562:Top2b UTSW 14 16,365,718 (GRCm38) missense probably benign 0.09
R9565:Top2b UTSW 14 16,365,718 (GRCm38) missense probably benign 0.09
R9798:Top2b UTSW 14 16,389,845 (GRCm38) missense probably damaging 1.00
X0028:Top2b UTSW 14 16,384,499 (GRCm38) nonsense probably null
Z1176:Top2b UTSW 14 16,395,434 (GRCm38) missense probably damaging 1.00
Z1177:Top2b UTSW 14 16,416,953 (GRCm38) missense probably benign
Predicted Primers PCR Primer
(F):5'- AGTTCAGAACCAGAACCTGC -3'
(R):5'- CATTCAAGTTCATTGTTGTGGCTC -3'

Sequencing Primer
(F):5'- CCAGAACCTGCATATTGTATGGC -3'
(R):5'- GCTTCTGCTTGCGCTAG -3'
Posted On 2019-10-17