Incidental Mutation 'R7663:Jag2'
ID591730
Institutional Source Beutler Lab
Gene Symbol Jag2
Ensembl Gene ENSMUSG00000002799
Gene Namejagged 2
SynonymsSerh, D12Ggc2e
MMRRC Submission
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R7663 (G1)
Quality Score225.009
Status Validated
Chromosome12
Chromosomal Location112907819-112929776 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 112913666 bp
ZygosityHeterozygous
Amino Acid Change Aspartic acid to Glycine at position 695 (D695G)
Ref Sequence ENSEMBL: ENSMUSP00000075224 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000075827]
Predicted Effect probably damaging
Transcript: ENSMUST00000075827
AA Change: D695G

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000075224
Gene: ENSMUSG00000002799
AA Change: D695G

DomainStartEndE-ValueType
signal peptide 1 23 N/A INTRINSIC
Pfam:MNNL 26 105 4.2e-31 PFAM
low complexity region 108 123 N/A INTRINSIC
DSL 178 240 1.48e-36 SMART
EGF_like 244 274 7.23e1 SMART
EGF 275 305 4.56e0 SMART
EGF_CA 307 345 8.5e-9 SMART
EGF 350 383 4e-5 SMART
EGF_CA 385 421 5.39e-11 SMART
EGF_CA 423 459 3.51e-10 SMART
EGF_CA 461 496 1.01e-10 SMART
EGF_CA 498 534 1.17e-6 SMART
EGF_CA 536 572 6.35e-8 SMART
EGF 588 634 7.53e-1 SMART
EGF_CA 636 672 2.89e-11 SMART
EGF 677 710 3.68e-4 SMART
EGF 715 748 1.32e-5 SMART
EGF 754 787 1.34e-6 SMART
EGF_CA 789 825 2.58e-8 SMART
EGF_CA 827 863 7.23e-12 SMART
VWC 872 949 1.3e-1 SMART
low complexity region 1002 1035 N/A INTRINSIC
transmembrane domain 1085 1107 N/A INTRINSIC
low complexity region 1109 1119 N/A INTRINSIC
low complexity region 1170 1199 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000223140
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.6%
  • 20x: 98.9%
Validation Efficiency 99% (68/69)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The Notch signaling pathway is an intercellular signaling mechanism that is essential for proper embryonic development. Members of the Notch gene family encode transmembrane receptors that are critical for various cell fate decisions. The protein encoded by this gene is one of several ligands that activate Notch and related receptors. Two transcript variants encoding different isoforms have been found for this gene. [provided by RefSeq, Jul 2008]
PHENOTYPE: Homozygotes for a targeted null mutation die perinatally with craniofacial defects, fused digits, and increased numbers of sensory hair cells in the cochlea. Homozygotes for a spontaneous mutation exhibit fused digits and sometimes tail kinks. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 74 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1110002E22Rik A G 3: 138,066,126 T359A probably damaging Het
Abcd4 A C 12: 84,606,129 V433G probably damaging Het
Acot5 C A 12: 84,069,581 R39S probably damaging Het
Actl9 T C 17: 33,433,469 S168P probably damaging Het
Adam15 A G 3: 89,345,806 L237P probably damaging Het
Ahctf1 T C 1: 179,790,314 Q289R possibly damaging Het
Arid5b C T 10: 68,098,587 G495E probably benign Het
Armh1 C A 4: 117,213,741 A396S probably benign Het
Asah1 C T 8: 41,341,627 R385Q probably damaging Het
AW549877 T C 15: 3,988,683 Y170C probably damaging Het
Bicc1 T C 10: 70,946,590 T607A probably benign Het
Ccdc88a T C 11: 29,498,614 probably null Het
Cdhr4 A T 9: 107,998,772 R750* probably null Het
Cep290 T A 10: 100,554,536 probably null Het
Clca3a1 T A 3: 144,737,036 D749V probably benign Het
Clcn1 C T 6: 42,310,063 P685S possibly damaging Het
Clk1 A G 1: 58,421,160 S104P probably damaging Het
Commd10 T C 18: 47,086,256 V172A probably benign Het
Cyp2c69 A T 19: 39,877,509 C213* probably null Het
Dnah14 A T 1: 181,752,155 probably null Het
Dock2 C T 11: 34,721,027 G170R probably damaging Het
Fam186a T G 15: 99,945,069 H1098P probably benign Het
Flt1 T C 5: 147,655,120 T511A probably benign Het
Fmo1 A C 1: 162,836,297 I221S possibly damaging Het
Fthl17b C T X: 8,962,804 R9Q possibly damaging Het
Fthl17b C T X: 8,962,808 V8M possibly damaging Het
Ginm1 A T 10: 7,775,362 S93R possibly damaging Het
Gm10251 A C 14: 6,675,701 probably null Het
Gm40460 ACCCCCACAGGAGCCACAGCCTCCCTTGCAGCCCCCACAGGAGCCACAGCCTCCCTTGCAGCCCCCACAGGAGCCACAGCCTCCCTTGCAGCCCCCACAGGAGCCACAGCCTCCCTTGCAGCCCCCACAGGAACTACAGCCTCCCTTGCAGCCCCCACAGGAACTACAGCCTCCCTTGCAGCCCCCACAGGAACTACAGCCTCCCTTGCAGCCCCCACAG ACCCCCACAGGAGCCACAGCCTCCCTTGCAGCCCCCACAGGAGCCACAGCCTCCCTTGCAGCCCCCACAGGAGCCACAGCCTCCCTTGCAGCCCCCACAGGAACTACAGCCTCCCTTGCAGCCCCCACAGGAACTACAGCCTCCCTTGCAGCCCCCACAGGAACTACAGCCTCCCTTGCAGCCCCCACAG 7: 142,240,713 probably benign Het
Gys2 C T 6: 142,459,485 R192H probably damaging Het
H2bfm G A X: 136,927,722 R120K unknown Het
Hectd4 C A 5: 121,324,031 A987E probably benign Het
Herc2 G A 7: 56,136,685 V1593I probably benign Het
Ighv14-3 T C 12: 114,059,934 T88A probably benign Het
Kazn A T 4: 142,104,898 D663E Het
Krt79 T C 15: 101,931,843 D306G probably damaging Het
Lama1 T A 17: 67,780,880 C1498S Het
Ldb1 T C 19: 46,035,524 Y141C probably damaging Het
Lmnb2 T A 10: 80,904,739 E336V probably damaging Het
Lrp1b T A 2: 42,653,035 probably benign Het
Mug1 C A 6: 121,861,220 H470N possibly damaging Het
Mycbp2 T A 14: 103,191,609 Y2377F probably damaging Het
Neb T A 2: 52,230,047 Y721F Het
Ntf3 A G 6: 126,101,815 S243P probably damaging Het
Olfr1195 G C 2: 88,683,352 P127A probably damaging Het
Olfr1480 G T 19: 13,530,445 M301I probably damaging Het
Olfr593 T C 7: 103,212,445 M195T possibly damaging Het
Pdk1 G A 2: 71,875,398 probably null Het
Pdzd2 A G 15: 12,373,203 V2282A probably damaging Het
Piwil1 T C 5: 128,747,433 F517L probably benign Het
Plch2 T A 4: 154,991,162 T738S probably damaging Het
Plekhm3 G A 1: 64,883,208 R603W probably damaging Het
Pltp A T 2: 164,857,006 probably null Het
Prdm4 A G 10: 85,899,281 S666P probably damaging Het
Psmb3 G T 11: 97,712,492 R177L probably damaging Het
Ralgapa2 A G 2: 146,418,415 V764A probably benign Het
Rel T C 11: 23,742,713 D440G probably benign Het
Rims2 T A 15: 39,507,026 V952E probably damaging Het
Samd4b G T 7: 28,423,500 C44* probably null Het
Slamf8 C A 1: 172,588,038 V78F possibly damaging Het
Slc35a1 A T 4: 34,675,493 N111K possibly damaging Het
Slc7a5 A T 8: 121,887,535 Y264* probably null Het
Srsf2 T C 11: 116,852,294 S134G unknown Het
Stag1 T A 9: 100,738,138 M98K probably damaging Het
Trib1 T C 15: 59,651,713 S199P probably damaging Het
Txnip T C 3: 96,559,837 S276P possibly damaging Het
Vmn1r194 C T 13: 22,244,741 T176I not run Het
Vmn1r222 A G 13: 23,232,431 L204P possibly damaging Het
Vmn2r63 T A 7: 42,927,042 H449L probably benign Het
Vmn2r83 T A 10: 79,479,122 N401K probably damaging Het
Vmn2r87 T A 10: 130,472,185 H728L probably damaging Het
Zfp69 G A 4: 120,935,126 A151V probably benign Het
Zfp738 A G 13: 67,683,401 probably null Het
Zfp974 T C 7: 27,911,685 E205G possibly damaging Het
Other mutations in Jag2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00157:Jag2 APN 12 112912718 missense probably benign 0.20
IGL00954:Jag2 APN 12 112920406 missense possibly damaging 0.50
IGL01532:Jag2 APN 12 112914363 missense probably damaging 0.98
IGL01646:Jag2 APN 12 112916349 missense possibly damaging 0.65
IGL02243:Jag2 APN 12 112916345 missense possibly damaging 0.94
IGL02447:Jag2 APN 12 112912612 missense probably damaging 1.00
IGL02458:Jag2 APN 12 112915993 missense probably damaging 0.98
IGL02516:Jag2 APN 12 112910566 missense probably damaging 1.00
IGL02574:Jag2 APN 12 112915511 missense probably benign 0.32
IGL02629:Jag2 APN 12 112914514 splice site probably benign
IGL02873:Jag2 APN 12 112910502 missense probably benign 0.00
IGL03087:Jag2 APN 12 112913948 missense possibly damaging 0.60
Jaguarundi UTSW 12 112915469 critical splice donor site probably null
R0068:Jag2 UTSW 12 112915193 splice site probably benign
R0310:Jag2 UTSW 12 112913377 unclassified probably benign
R0963:Jag2 UTSW 12 112915314 missense probably damaging 1.00
R1188:Jag2 UTSW 12 112920121 nonsense probably null
R1256:Jag2 UTSW 12 112914419 missense possibly damaging 0.50
R1298:Jag2 UTSW 12 112916319 unclassified probably benign
R1317:Jag2 UTSW 12 112914501 missense probably benign
R2079:Jag2 UTSW 12 112920377 missense probably damaging 1.00
R2345:Jag2 UTSW 12 112909064 missense probably damaging 1.00
R4654:Jag2 UTSW 12 112913646 missense probably benign 0.13
R4782:Jag2 UTSW 12 112914249 missense probably benign
R4798:Jag2 UTSW 12 112916632 missense probably benign 0.01
R5242:Jag2 UTSW 12 112916866 missense probably damaging 0.97
R5350:Jag2 UTSW 12 112908922 missense possibly damaging 0.77
R5364:Jag2 UTSW 12 112910534 missense probably damaging 1.00
R6129:Jag2 UTSW 12 112920349 nonsense probably null
R6362:Jag2 UTSW 12 112920122 missense probably damaging 0.97
R6376:Jag2 UTSW 12 112909329 missense probably benign 0.00
R6819:Jag2 UTSW 12 112910541 missense probably damaging 1.00
R6844:Jag2 UTSW 12 112916714 missense probably damaging 1.00
R6968:Jag2 UTSW 12 112914258 missense probably benign 0.10
R7514:Jag2 UTSW 12 112929052 missense probably benign 0.19
R7730:Jag2 UTSW 12 112922041 missense probably damaging 1.00
R7754:Jag2 UTSW 12 112915469 critical splice donor site probably null
R7828:Jag2 UTSW 12 112913180 missense probably benign 0.19
R7874:Jag2 UTSW 12 112915946 missense probably damaging 0.99
R8075:Jag2 UTSW 12 112915274 missense probably benign 0.05
Predicted Primers PCR Primer
(F):5'- TCATAGCATGTGCCACCGTTG -3'
(R):5'- TACATGGGCCTGAAGTCATG -3'

Sequencing Primer
(F):5'- TGTAGGCGTCACACTGGAACTC -3'
(R):5'- CCTGAAGTCATGGGGTGGAATCC -3'
Posted On2019-11-12