Incidental Mutation 'R7670:Clic4'
ID592088
Institutional Source Beutler Lab
Gene Symbol Clic4
Ensembl Gene ENSMUSG00000037242
Gene Namechloride intracellular channel 4 (mitochondrial)
SynonymsD0Jmb3, mc3s5, mtCLIC
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R7670 (G1)
Quality Score225.009
Status Validated
Chromosome4
Chromosomal Location135213969-135272814 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 135217205 bp
ZygosityHeterozygous
Amino Acid Change Tyrosine to Histidine at position 220 (Y220H)
Ref Sequence ENSEMBL: ENSMUSP00000041453 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000037099]
Predicted Effect probably damaging
Transcript: ENSMUST00000037099
AA Change: Y220H

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000041453
Gene: ENSMUSG00000037242
AA Change: Y220H

DomainStartEndE-ValueType
Pfam:GST_N_3 31 103 7.3e-9 PFAM
Pfam:GST_C_2 134 223 2.7e-10 PFAM
Meta Mutation Damage Score 0.7188 question?
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 100.0%
  • 10x: 99.8%
  • 20x: 99.4%
Validation Efficiency 100% (62/62)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] Chloride channels are a diverse group of proteins that regulate fundamental cellular processes including stabilization of cell membrane potential, transepithelial transport, maintenance of intracellular pH, and regulation of cell volume. Chloride intracellular channel 4 (CLIC4) protein, encoded by the CLIC4 gene, is a member of the p64 family; the gene is expressed in many tissues and exhibits a intracellular vesicular pattern in Panc-1 cells (pancreatic cancer cells). [provided by RefSeq, Jul 2008]
PHENOTYPE: Mice homozygous for null mutations may display decreased survival, body weight and female fertility, impaired angiogenesis, increased suscpetibility to Listeria infection, increased resistance to LPS treatment, skin erosions and/or delayed wound healing. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 62 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4930435E12Rik C T 16: 38,828,091 D219N possibly damaging Het
Adam26a T A 8: 43,570,153 H100L probably benign Het
Adgrf2 T C 17: 42,711,372 N187S probably damaging Het
Adipoq T A 16: 23,157,582 H244Q probably damaging Het
Arhgap40 T A 2: 158,531,925 S209T probably benign Het
Arrdc3 C T 13: 80,889,093 L123F probably damaging Het
Aspscr1 A G 11: 120,689,039 N212D probably benign Het
Ccr9 A T 9: 123,779,306 S18C probably damaging Het
Cdc42bpa T A 1: 180,065,081 V270D probably damaging Het
Cntln A C 4: 84,979,340 H388P possibly damaging Het
Col12a1 A G 9: 79,631,643 V2457A probably damaging Het
Ctsk A G 3: 95,501,614 N103D probably benign Het
Ddx60 T C 8: 61,975,792 S779P probably damaging Het
Dnah5 T A 15: 28,246,232 probably null Het
Dnah7b T A 1: 46,109,302 D279E probably benign Het
Fam117a A G 11: 95,378,834 N308S probably benign Het
Fasn A G 11: 120,813,419 V1419A probably damaging Het
Fhad1 A G 4: 141,951,491 S625P probably benign Het
Gemin5 A G 11: 58,147,928 V585A probably benign Het
Gm5145 C A 17: 20,570,384 P8Q probably benign Het
Gm8332 T C 12: 88,249,754 N116S probably benign Het
Herc1 C A 9: 66,416,347 T1381K probably damaging Het
Herc6 T C 6: 57,660,122 I824T probably damaging Het
Klrb1 C T 6: 128,710,087 V161I probably benign Het
Krtap31-1 A G 11: 99,908,432 N154D not run Het
Lcp1 A T 14: 75,200,431 I94F probably benign Het
Lin7a A T 10: 107,382,691 Q154L possibly damaging Het
Lnx1 T C 5: 74,685,690 Y33C probably damaging Het
Myo5b T C 18: 74,701,446 V859A probably benign Het
Ncbp1 A G 4: 46,170,015 Q696R probably damaging Het
Neurl1b C G 17: 26,438,746 H219Q probably benign Het
Nme8 T C 13: 19,658,829 E392G probably benign Het
Nufip1 CAAAACAGAAAACAGAAAAC CAAAACAGAAAACAGAAAACAGAAAAC 14: 76,111,974 probably null Het
Nuggc A G 14: 65,613,526 I298V probably damaging Het
Nup155 A C 15: 8,153,696 K1247Q probably damaging Het
Olfr368 A T 2: 37,331,759 E4V probably benign Het
Olfr403 A G 11: 74,196,207 K235E probably damaging Het
Otud4 T A 8: 79,655,864 probably null Het
Pcdhb18 T C 18: 37,491,696 V693A probably damaging Het
Pcnx3 A G 19: 5,677,182 F1108L probably benign Het
Prkca A T 11: 108,014,344 N189K probably damaging Het
Rbm24 A G 13: 46,429,207 I201V probably benign Het
Reep6 T C 10: 80,333,793 L105P probably damaging Het
Retreg1 T C 15: 25,941,040 probably benign Het
Rev3l C T 10: 39,836,722 T2382I probably benign Het
Rnf31 A G 14: 55,594,361 N230S probably benign Het
Rreb1 T C 13: 37,931,572 L969P probably benign Het
Rsph4a T A 10: 33,909,033 N313K probably damaging Het
Serpina3f T A 12: 104,217,266 L129Q probably damaging Het
Slc9a2 T A 1: 40,718,997 V232D probably damaging Het
Stmn2 T C 3: 8,554,865 L121P probably damaging Het
Svep1 C T 4: 58,097,424 G1373D probably damaging Het
Tmem206 A G 1: 191,340,868 N162S probably benign Het
Tns1 C A 1: 73,952,477 R1014L possibly damaging Het
Top2b T C 14: 16,416,620 S1127P possibly damaging Het
Txndc16 A T 14: 45,135,867 C768* probably null Het
Ubl7 A T 9: 57,929,769 E354D probably benign Het
Ush2a T C 1: 188,784,708 L3205P possibly damaging Het
Xirp2 A G 2: 67,510,573 T1053A possibly damaging Het
Zbtb21 A G 16: 97,951,877 L402P probably damaging Het
Zfp27 T A 7: 29,894,796 K581N possibly damaging Het
Zfp62 A T 11: 49,215,076 probably benign Het
Other mutations in Clic4
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01564:Clic4 APN 4 135217193 missense probably damaging 0.99
IGL01674:Clic4 APN 4 135238893 missense probably benign 0.01
IGL03343:Clic4 APN 4 135218578 missense possibly damaging 0.91
IGL03372:Clic4 APN 4 135218614 missense probably damaging 0.99
R1643:Clic4 UTSW 4 135238895 missense possibly damaging 0.69
R2201:Clic4 UTSW 4 135223539 missense probably damaging 1.00
R4181:Clic4 UTSW 4 135226039 missense probably benign 0.00
R4302:Clic4 UTSW 4 135226039 missense probably benign 0.00
R4335:Clic4 UTSW 4 135218605 missense probably benign 0.15
R4600:Clic4 UTSW 4 135238989 intron probably null
R4939:Clic4 UTSW 4 135223541 missense probably benign 0.16
R5359:Clic4 UTSW 4 135217135 missense probably benign 0.00
R5437:Clic4 UTSW 4 135217246 missense probably damaging 1.00
R5902:Clic4 UTSW 4 135272558 missense probably benign
Predicted Primers PCR Primer
(F):5'- AGCAGTCTGTTAGGAAAGCG -3'
(R):5'- AGTGTGCCGTCCTAGTCTAC -3'

Sequencing Primer
(F):5'- CAGTCTGTTAGGAAAGCGGATTCTC -3'
(R):5'- CAGAAATGGGTGCCTTTACGC -3'
Posted On2019-11-12