Incidental Mutation 'R7688:Leng1'
ID593204
Institutional Source Beutler Lab
Gene Symbol Leng1
Ensembl Gene ENSMUSG00000078813
Gene Nameleukocyte receptor cluster (LRC) member 1
Synonyms
Accession Numbers
Is this an essential gene? Possibly essential (E-score: 0.621) question?
Stock #R7688 (G1)
Quality Score225.009
Status Validated
Chromosome7
Chromosomal Location3660098-3665840 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) G to A at 3662810 bp
ZygosityHeterozygous
Amino Acid Change Proline to Leucine at position 176 (P176L)
Ref Sequence ENSEMBL: ENSMUSP00000019878 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000019878] [ENSMUST00000038743] [ENSMUST00000038913] [ENSMUST00000121743] [ENSMUST00000145034] [ENSMUST00000160200]
Predicted Effect probably benign
Transcript: ENSMUST00000019878
AA Change: P176L

PolyPhen 2 Score 0.009 (Sensitivity: 0.96; Specificity: 0.77)
SMART Domains Protein: ENSMUSP00000019878
Gene: ENSMUSG00000078813
AA Change: P176L

DomainStartEndE-ValueType
Cir_N 8 44 2.43e-9 SMART
low complexity region 94 109 N/A INTRINSIC
low complexity region 171 192 N/A INTRINSIC
coiled coil region 198 222 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000038743
SMART Domains Protein: ENSMUSP00000043853
Gene: ENSMUSG00000019734

DomainStartEndE-ValueType
transmembrane domain 151 173 N/A INTRINSIC
low complexity region 177 191 N/A INTRINSIC
transmembrane domain 232 251 N/A INTRINSIC
transmembrane domain 332 354 N/A INTRINSIC
transmembrane domain 374 396 N/A INTRINSIC
transmembrane domain 409 431 N/A INTRINSIC
Pfam:TMC 457 567 2.5e-42 PFAM
transmembrane domain 572 594 N/A INTRINSIC
transmembrane domain 637 659 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000038913
SMART Domains Protein: ENSMUSP00000039098
Gene: ENSMUSG00000035632

DomainStartEndE-ValueType
Pfam:Not3 3 232 6.5e-99 PFAM
low complexity region 257 274 N/A INTRINSIC
low complexity region 316 338 N/A INTRINSIC
low complexity region 384 426 N/A INTRINSIC
low complexity region 441 450 N/A INTRINSIC
low complexity region 473 509 N/A INTRINSIC
low complexity region 570 587 N/A INTRINSIC
Pfam:NOT2_3_5 618 745 3.7e-44 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000121743
SMART Domains Protein: ENSMUSP00000112541
Gene: ENSMUSG00000019734

DomainStartEndE-ValueType
transmembrane domain 84 106 N/A INTRINSIC
low complexity region 110 124 N/A INTRINSIC
transmembrane domain 165 184 N/A INTRINSIC
transmembrane domain 265 287 N/A INTRINSIC
transmembrane domain 307 329 N/A INTRINSIC
transmembrane domain 342 364 N/A INTRINSIC
Pfam:TMC 390 500 1.4e-40 PFAM
transmembrane domain 505 527 N/A INTRINSIC
transmembrane domain 570 592 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000135977
SMART Domains Protein: ENSMUSP00000118822
Gene: ENSMUSG00000035632

DomainStartEndE-ValueType
Pfam:Not3 1 78 1.1e-28 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000145034
Predicted Effect probably benign
Transcript: ENSMUST00000160200
SMART Domains Protein: ENSMUSP00000124810
Gene: ENSMUSG00000035632

DomainStartEndE-ValueType
Pfam:NOT2_3_5 1 83 3.1e-25 PFAM
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 100.0%
  • 10x: 99.7%
  • 20x: 99.2%
Validation Efficiency 100% (47/47)
Allele List at MGI
Other mutations in this stock
Total: 46 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Bag6 T C 17: 35,146,892 Y1102H probably damaging Het
Cldn24 G A 8: 47,822,705 C188Y probably damaging Het
Dennd4c T C 4: 86,795,140 W443R probably damaging Het
Dmxl1 T A 18: 49,955,871 C2806S probably benign Het
Epb41l2 T C 10: 25,479,138 Y449H probably damaging Het
Ets1 T A 9: 32,696,424 I14N probably benign Het
F11 A T 8: 45,250,090 F188I probably damaging Het
Fam13a C T 6: 58,935,707 V654I probably benign Het
Flt1 C T 5: 147,676,325 V369I probably benign Het
Focad T A 4: 88,178,133 Y251N probably damaging Het
Gm14025 G A 2: 129,039,044 Q321* probably null Het
Gm5150 A G 3: 15,963,583 S175P probably benign Het
Hnrnpul2 T A 19: 8,820,630 S117T probably benign Het
Kcnj5 A G 9: 32,322,968 V17A probably benign Het
Kctd1 T G 18: 14,974,198 T737P probably benign Het
Kif14 T C 1: 136,494,654 V894A probably damaging Het
Klhl12 A T 1: 134,489,030 T497S probably benign Het
Klhl6 C A 16: 19,947,131 V574L probably damaging Het
Lama1 A T 17: 67,761,628 D774V Het
Lig1 T C 7: 13,289,463 L196P probably benign Het
Macrod1 C A 19: 7,196,865 Y245* probably null Het
Mcf2l T A 8: 12,948,130 I6N possibly damaging Het
Megf11 A G 9: 64,691,864 D687G possibly damaging Het
Muc4 A T 16: 32,751,460 H446L possibly damaging Het
Oasl2 A T 5: 114,897,848 I62F probably benign Het
Olfr1271 A T 2: 90,265,615 F272I probably damaging Het
Olfr298 A G 7: 86,488,975 V192A probably benign Het
Olfr671 C A 7: 104,975,125 A291S possibly damaging Het
Oog4 CAA CA 4: 143,437,452 probably null Het
Pdcl2 T C 5: 76,317,923 N150S probably benign Het
Pfkfb3 A G 2: 11,492,639 Y54H probably damaging Het
Rab25 A T 3: 88,544,963 probably null Het
Slc22a18 G A 7: 143,479,823 G104S probably damaging Het
Slc44a5 T A 3: 153,973,800 probably null Het
Slc5a8 A G 10: 88,921,699 Y517C probably damaging Het
Spata18 A G 5: 73,651,662 N26S probably benign Het
Tas2r115 T A 6: 132,737,680 S103C probably damaging Het
Tigd2 T A 6: 59,210,397 M83K probably damaging Het
Tnxb T A 17: 34,671,906 C408S probably benign Het
Trbj2-3 T A 6: 41,543,225 S1R possibly damaging Het
Triobp T C 15: 78,961,111 probably null Het
Uaca A G 9: 60,874,127 Q1349R probably benign Het
Ube2j2 T A 4: 155,956,428 L171I probably damaging Het
Usp17ld C A 7: 103,250,775 G317W probably damaging Het
Vmn2r72 T A 7: 85,754,890 D31V probably benign Het
Zfp317 T G 9: 19,647,955 H488Q probably damaging Het
Other mutations in Leng1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL03118:Leng1 APN 7 3665410 missense probably damaging 1.00
R1955:Leng1 UTSW 7 3665416 missense probably damaging 1.00
R2051:Leng1 UTSW 7 3665401 missense probably damaging 1.00
R6127:Leng1 UTSW 7 3662867 missense probably damaging 1.00
R6505:Leng1 UTSW 7 3661212 nonsense probably null
R7578:Leng1 UTSW 7 3665383 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- ACATACCCTTAGCCATAAGAGGAG -3'
(R):5'- ATCCTGACTTACTTGGGCCAG -3'

Sequencing Primer
(F):5'- CTTAGCCATAAGAGGAGATGCTGTTC -3'
(R):5'- ACTTACTTGGGCCAGAGTGCAG -3'
Posted On2019-11-12