Incidental Mutation 'R7688:Oasl2'
ID593198
Institutional Source Beutler Lab
Gene Symbol Oasl2
Ensembl Gene ENSMUSG00000029561
Gene Name2'-5' oligoadenylate synthetase-like 2
SynonymsMmu-OASL, M1204
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R7688 (G1)
Quality Score225.009
Status Validated
Chromosome5
Chromosomal Location114896936-114912234 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to T at 114897848 bp
ZygosityHeterozygous
Amino Acid Change Isoleucine to Phenylalanine at position 62 (I62F)
Ref Sequence ENSEMBL: ENSMUSP00000031542 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000031542] [ENSMUST00000124716] [ENSMUST00000146072] [ENSMUST00000150361]
Predicted Effect probably benign
Transcript: ENSMUST00000031542
AA Change: I62F

PolyPhen 2 Score 0.009 (Sensitivity: 0.96; Specificity: 0.77)
SMART Domains Protein: ENSMUSP00000031542
Gene: ENSMUSG00000029561
AA Change: I62F

DomainStartEndE-ValueType
low complexity region 63 73 N/A INTRINSIC
Pfam:OAS1_C 169 351 8.4e-77 PFAM
SCOP:d1euvb_ 355 427 4e-4 SMART
Blast:UBQ 355 430 9e-30 BLAST
UBQ 435 506 8.88e-11 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000124716
SMART Domains Protein: ENSMUSP00000115070
Gene: ENSMUSG00000029561

DomainStartEndE-ValueType
Pfam:OAS1_C 1 131 1.2e-48 PFAM
SCOP:d1euvb_ 135 207 6e-5 SMART
Blast:UBQ 135 210 9e-32 BLAST
Blast:UBQ 215 240 5e-10 BLAST
Predicted Effect
Predicted Effect probably benign
Transcript: ENSMUST00000146072
AA Change: I62F

PolyPhen 2 Score 0.009 (Sensitivity: 0.96; Specificity: 0.77)
SMART Domains Protein: ENSMUSP00000117795
Gene: ENSMUSG00000029561
AA Change: I62F

DomainStartEndE-ValueType
PDB:1PX5|B 6 101 4e-10 PDB
Predicted Effect probably benign
Transcript: ENSMUST00000150361
AA Change: I62F

PolyPhen 2 Score 0.009 (Sensitivity: 0.96; Specificity: 0.77)
SMART Domains Protein: ENSMUSP00000119042
Gene: ENSMUSG00000029561
AA Change: I62F

DomainStartEndE-ValueType
PDB:1PX5|B 6 140 3e-13 PDB
Meta Mutation Damage Score 0.0898 question?
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 100.0%
  • 10x: 99.7%
  • 20x: 99.2%
Validation Efficiency 100% (47/47)
Allele List at MGI
Other mutations in this stock
Total: 46 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Bag6 T C 17: 35,146,892 Y1102H probably damaging Het
Cldn24 G A 8: 47,822,705 C188Y probably damaging Het
Dennd4c T C 4: 86,795,140 W443R probably damaging Het
Dmxl1 T A 18: 49,955,871 C2806S probably benign Het
Epb41l2 T C 10: 25,479,138 Y449H probably damaging Het
Ets1 T A 9: 32,696,424 I14N probably benign Het
F11 A T 8: 45,250,090 F188I probably damaging Het
Fam13a C T 6: 58,935,707 V654I probably benign Het
Flt1 C T 5: 147,676,325 V369I probably benign Het
Focad T A 4: 88,178,133 Y251N probably damaging Het
Gm14025 G A 2: 129,039,044 Q321* probably null Het
Gm5150 A G 3: 15,963,583 S175P probably benign Het
Hnrnpul2 T A 19: 8,820,630 S117T probably benign Het
Kcnj5 A G 9: 32,322,968 V17A probably benign Het
Kctd1 T G 18: 14,974,198 T737P probably benign Het
Kif14 T C 1: 136,494,654 V894A probably damaging Het
Klhl12 A T 1: 134,489,030 T497S probably benign Het
Klhl6 C A 16: 19,947,131 V574L probably damaging Het
Lama1 A T 17: 67,761,628 D774V Het
Leng1 G A 7: 3,662,810 P176L probably benign Het
Lig1 T C 7: 13,289,463 L196P probably benign Het
Macrod1 C A 19: 7,196,865 Y245* probably null Het
Mcf2l T A 8: 12,948,130 I6N possibly damaging Het
Megf11 A G 9: 64,691,864 D687G possibly damaging Het
Muc4 A T 16: 32,751,460 H446L possibly damaging Het
Olfr1271 A T 2: 90,265,615 F272I probably damaging Het
Olfr298 A G 7: 86,488,975 V192A probably benign Het
Olfr671 C A 7: 104,975,125 A291S possibly damaging Het
Oog4 CAA CA 4: 143,437,452 probably null Het
Pdcl2 T C 5: 76,317,923 N150S probably benign Het
Pfkfb3 A G 2: 11,492,639 Y54H probably damaging Het
Rab25 A T 3: 88,544,963 probably null Het
Slc22a18 G A 7: 143,479,823 G104S probably damaging Het
Slc44a5 T A 3: 153,973,800 probably null Het
Slc5a8 A G 10: 88,921,699 Y517C probably damaging Het
Spata18 A G 5: 73,651,662 N26S probably benign Het
Tas2r115 T A 6: 132,737,680 S103C probably damaging Het
Tigd2 T A 6: 59,210,397 M83K probably damaging Het
Tnxb T A 17: 34,671,906 C408S probably benign Het
Trbj2-3 T A 6: 41,543,225 S1R possibly damaging Het
Triobp T C 15: 78,961,111 probably null Het
Uaca A G 9: 60,874,127 Q1349R probably benign Het
Ube2j2 T A 4: 155,956,428 L171I probably damaging Het
Usp17ld C A 7: 103,250,775 G317W probably damaging Het
Vmn2r72 T A 7: 85,754,890 D31V probably benign Het
Zfp317 T G 9: 19,647,955 H488Q probably damaging Het
Other mutations in Oasl2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL02054:Oasl2 APN 5 114897806 missense probably damaging 1.00
IGL02649:Oasl2 APN 5 114897692 missense probably damaging 1.00
IGL02810:Oasl2 APN 5 114897791 missense probably damaging 1.00
IGL03153:Oasl2 APN 5 114901332 missense probably benign 0.02
R0179:Oasl2 UTSW 5 114910912 missense probably benign
R1318:Oasl2 UTSW 5 114901381 missense probably benign 0.01
R1831:Oasl2 UTSW 5 114901306 missense probably benign 0.00
R1941:Oasl2 UTSW 5 114911362 utr 3 prime probably benign
R2068:Oasl2 UTSW 5 114911237 missense probably benign 0.01
R2104:Oasl2 UTSW 5 114911002 nonsense probably null
R2170:Oasl2 UTSW 5 114906800 missense probably damaging 0.99
R2437:Oasl2 UTSW 5 114911296 missense probably benign
R2882:Oasl2 UTSW 5 114911023 missense probably damaging 1.00
R3960:Oasl2 UTSW 5 114905037 missense probably benign 0.03
R3962:Oasl2 UTSW 5 114897747 missense probably benign 0.01
R4609:Oasl2 UTSW 5 114899796 missense possibly damaging 0.47
R4761:Oasl2 UTSW 5 114899775 missense probably benign 0.00
R5242:Oasl2 UTSW 5 114905061 missense possibly damaging 0.92
R5691:Oasl2 UTSW 5 114899767 missense possibly damaging 0.93
R6594:Oasl2 UTSW 5 114906775 missense probably benign 0.30
R7053:Oasl2 UTSW 5 114911230 missense possibly damaging 0.82
R7062:Oasl2 UTSW 5 114911091 nonsense probably null
R7753:Oasl2 UTSW 5 114905057 missense probably benign
R8026:Oasl2 UTSW 5 114902268 unclassified probably benign
Predicted Primers PCR Primer
(F):5'- TATCTAGAGGACAGGCTGGC -3'
(R):5'- TGTCCTTCAGCATTGCAAGG -3'

Sequencing Primer
(F):5'- AGCTGAAATGGACCCGTTC -3'
(R):5'- GCAAGGCTAATTTTAAATGCACAG -3'
Posted On2019-11-12