Incidental Mutation 'R7688:Klhl6'
ID593221
Institutional Source Beutler Lab
Gene Symbol Klhl6
Ensembl Gene ENSMUSG00000043008
Gene Namekelch-like 6
Synonyms
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.086) question?
Stock #R7688 (G1)
Quality Score225.009
Status Validated
Chromosome16
Chromosomal Location19946496-19983037 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) C to A at 19947131 bp
ZygosityHeterozygous
Amino Acid Change Valine to Leucine at position 574 (V574L)
Ref Sequence ENSEMBL: ENSMUSP00000053023 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000058839]
Predicted Effect probably damaging
Transcript: ENSMUST00000058839
AA Change: V574L

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000053023
Gene: ENSMUSG00000043008
AA Change: V574L

DomainStartEndE-ValueType
BTB 70 167 1.43e-25 SMART
BACK 172 274 1.68e-35 SMART
Kelch 376 419 3.05e-1 SMART
Kelch 420 466 6.82e-11 SMART
Kelch 467 514 4.27e-3 SMART
Kelch 515 556 3.06e-4 SMART
Kelch 557 604 3.47e-3 SMART
Meta Mutation Damage Score 0.4896 question?
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 100.0%
  • 10x: 99.7%
  • 20x: 99.2%
Validation Efficiency 100% (47/47)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of the kelch-like (KLHL) family of proteins, which is involved in B-lymphocyte antigen receptor signaling and germinal-center B-cell maturation. The encoded protein contains an N-terminal broad-complex, tramtrack and bric a brac (BTB) domain that facilitates protein binding and dimerization, a BTB and C-terminal kelch (BACK) domain, and six C-terminal kelch repeat domains. Naturally occurring mutations in this gene are associated with chronic lymphocytic leukemia. Alternative splicing results in multiple transcript variants. [provided by RefSeq, Feb 2017]
PHENOTYPE: Mice homozygous for a knock-out allele exhibit spleen hypoplasia, defects in mature B-cell subsets with normal pro- and pre-B-cell development, severely impaired antigen-dependent germinal center formation, and reduced memory IgG response. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 46 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Bag6 T C 17: 35,146,892 Y1102H probably damaging Het
Cldn24 G A 8: 47,822,705 C188Y probably damaging Het
Dennd4c T C 4: 86,795,140 W443R probably damaging Het
Dmxl1 T A 18: 49,955,871 C2806S probably benign Het
Epb41l2 T C 10: 25,479,138 Y449H probably damaging Het
Ets1 T A 9: 32,696,424 I14N probably benign Het
F11 A T 8: 45,250,090 F188I probably damaging Het
Fam13a C T 6: 58,935,707 V654I probably benign Het
Flt1 C T 5: 147,676,325 V369I probably benign Het
Focad T A 4: 88,178,133 Y251N probably damaging Het
Gm14025 G A 2: 129,039,044 Q321* probably null Het
Gm5150 A G 3: 15,963,583 S175P probably benign Het
Hnrnpul2 T A 19: 8,820,630 S117T probably benign Het
Kcnj5 A G 9: 32,322,968 V17A probably benign Het
Kctd1 T G 18: 14,974,198 T737P probably benign Het
Kif14 T C 1: 136,494,654 V894A probably damaging Het
Klhl12 A T 1: 134,489,030 T497S probably benign Het
Lama1 A T 17: 67,761,628 D774V Het
Leng1 G A 7: 3,662,810 P176L probably benign Het
Lig1 T C 7: 13,289,463 L196P probably benign Het
Macrod1 C A 19: 7,196,865 Y245* probably null Het
Mcf2l T A 8: 12,948,130 I6N possibly damaging Het
Megf11 A G 9: 64,691,864 D687G possibly damaging Het
Muc4 A T 16: 32,751,460 H446L possibly damaging Het
Oasl2 A T 5: 114,897,848 I62F probably benign Het
Olfr1271 A T 2: 90,265,615 F272I probably damaging Het
Olfr298 A G 7: 86,488,975 V192A probably benign Het
Olfr671 C A 7: 104,975,125 A291S possibly damaging Het
Oog4 CAA CA 4: 143,437,452 probably null Het
Pdcl2 T C 5: 76,317,923 N150S probably benign Het
Pfkfb3 A G 2: 11,492,639 Y54H probably damaging Het
Rab25 A T 3: 88,544,963 probably null Het
Slc22a18 G A 7: 143,479,823 G104S probably damaging Het
Slc44a5 T A 3: 153,973,800 probably null Het
Slc5a8 A G 10: 88,921,699 Y517C probably damaging Het
Spata18 A G 5: 73,651,662 N26S probably benign Het
Tas2r115 T A 6: 132,737,680 S103C probably damaging Het
Tigd2 T A 6: 59,210,397 M83K probably damaging Het
Tnxb T A 17: 34,671,906 C408S probably benign Het
Trbj2-3 T A 6: 41,543,225 S1R possibly damaging Het
Triobp T C 15: 78,961,111 probably null Het
Uaca A G 9: 60,874,127 Q1349R probably benign Het
Ube2j2 T A 4: 155,956,428 L171I probably damaging Het
Usp17ld C A 7: 103,250,775 G317W probably damaging Het
Vmn2r72 T A 7: 85,754,890 D31V probably benign Het
Zfp317 T G 9: 19,647,955 H488Q probably damaging Het
Other mutations in Klhl6
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00788:Klhl6 APN 16 19957062 missense probably benign 0.00
IGL01465:Klhl6 APN 16 19982822 missense probably damaging 0.98
IGL01831:Klhl6 APN 16 19953485 missense probably damaging 1.00
IGL01971:Klhl6 APN 16 19949526 missense probably damaging 0.99
IGL02532:Klhl6 APN 16 19957082 missense possibly damaging 0.84
IGL03113:Klhl6 APN 16 19957251 missense possibly damaging 0.68
IGL03290:Klhl6 APN 16 19947137 missense probably benign 0.44
Ascension UTSW 16 19947098 missense probably damaging 1.00
besmirched UTSW 16 19949447 splice site probably null
blau UTSW 16 19957005 missense probably damaging 1.00
blossom UTSW 16 19957139 missense probably damaging 1.00
cerulean UTSW 16 19957218 nonsense probably null
heights UTSW 16 19957028 missense probably damaging 0.98
Lazuli UTSW 16 19956966 frame shift probably null
Parula UTSW 16 19957043 missense possibly damaging 0.56
torres_del_paine UTSW 16 19948127 missense probably damaging 1.00
turquoise UTSW 16 19982796 missense probably damaging 1.00
IGL03046:Klhl6 UTSW 16 19982889 missense probably benign
R0265:Klhl6 UTSW 16 19948234 missense probably benign 0.43
R0496:Klhl6 UTSW 16 19956966 frame shift probably null
R0497:Klhl6 UTSW 16 19956966 frame shift probably null
R0540:Klhl6 UTSW 16 19957014 missense possibly damaging 0.95
R0541:Klhl6 UTSW 16 19949447 splice site probably null
R0554:Klhl6 UTSW 16 19953593 missense probably damaging 0.96
R0607:Klhl6 UTSW 16 19957014 missense possibly damaging 0.95
R0636:Klhl6 UTSW 16 19948073 splice site probably benign
R0670:Klhl6 UTSW 16 19949559 missense possibly damaging 0.92
R1477:Klhl6 UTSW 16 19965977 missense probably benign 0.00
R1510:Klhl6 UTSW 16 19947098 missense probably damaging 1.00
R1547:Klhl6 UTSW 16 19966082 missense probably benign
R1747:Klhl6 UTSW 16 19947028 missense probably benign 0.40
R1871:Klhl6 UTSW 16 19957043 missense possibly damaging 0.56
R1966:Klhl6 UTSW 16 19982822 missense probably damaging 0.98
R2058:Klhl6 UTSW 16 19982931 missense probably benign
R4466:Klhl6 UTSW 16 19957268 missense probably damaging 0.99
R4645:Klhl6 UTSW 16 19947147 missense probably damaging 1.00
R4690:Klhl6 UTSW 16 19957284 missense probably benign 0.44
R4824:Klhl6 UTSW 16 19957028 missense probably damaging 0.98
R4833:Klhl6 UTSW 16 19957139 missense probably damaging 1.00
R4835:Klhl6 UTSW 16 19957033 missense probably benign 0.07
R5001:Klhl6 UTSW 16 19946991 makesense probably null
R5475:Klhl6 UTSW 16 19948127 missense probably damaging 1.00
R5700:Klhl6 UTSW 16 19957218 nonsense probably null
R5867:Klhl6 UTSW 16 19982820 missense probably benign 0.37
R5910:Klhl6 UTSW 16 19957094 missense probably benign 0.04
R6992:Klhl6 UTSW 16 19953587 missense probably damaging 1.00
R7082:Klhl6 UTSW 16 19982883 missense probably benign 0.00
R7262:Klhl6 UTSW 16 19982796 missense probably damaging 1.00
R7314:Klhl6 UTSW 16 19957005 missense probably damaging 1.00
R7464:Klhl6 UTSW 16 19957113 missense possibly damaging 0.58
R8319:Klhl6 UTSW 16 19957190 missense possibly damaging 0.74
Z1176:Klhl6 UTSW 16 19953674 missense probably damaging 1.00
Z1177:Klhl6 UTSW 16 19982961 nonsense probably null
Predicted Primers PCR Primer
(F):5'- TATGGCTCACAAGGAACGAC -3'
(R):5'- CAGAAAGATGACCAGCATGC -3'

Sequencing Primer
(F):5'- CGACGTGGGCAAGCTAG -3'
(R):5'- GATGACCAGCATGCATGTTC -3'
Posted On2019-11-12