Incidental Mutation 'R7713:Lrrc32'
ID594731
Institutional Source Beutler Lab
Gene Symbol Lrrc32
Ensembl Gene ENSMUSG00000090958
Gene Nameleucine rich repeat containing 32
SynonymsD7H11S833E, EG434215, Garp, D11S833Eh
MMRRC Submission
Accession Numbers
Is this an essential gene? Possibly non essential (E-score: 0.266) question?
Stock #R7713 (G1)
Quality Score225.009
Status Not validated
Chromosome7
Chromosomal Location98489283-98502181 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) G to T at 98499338 bp
ZygosityHeterozygous
Amino Acid Change Glycine to Tryptophan at position 442 (G442W)
Ref Sequence ENSEMBL: ENSMUSP00000133205 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000165205] [ENSMUST00000205937] [ENSMUST00000205956]
Predicted Effect probably damaging
Transcript: ENSMUST00000165205
AA Change: G442W

PolyPhen 2 Score 0.987 (Sensitivity: 0.73; Specificity: 0.96)
SMART Domains Protein: ENSMUSP00000133205
Gene: ENSMUSG00000090958
AA Change: G442W

DomainStartEndE-ValueType
signal peptide 1 17 N/A INTRINSIC
Blast:LRRNT 22 54 3e-12 BLAST
LRR_TYP 73 96 9.44e-2 SMART
LRR 97 123 1.86e2 SMART
LRR 124 148 3.01e2 SMART
LRR 149 172 5.41e0 SMART
LRR 173 196 1.51e0 SMART
LRR_TYP 197 220 7.67e-2 SMART
LRR 265 287 1.49e2 SMART
LRR 315 338 4.97e0 SMART
LRR 339 362 8.01e0 SMART
LRR 363 384 5.57e1 SMART
LRR_TYP 386 409 3.44e-4 SMART
low complexity region 425 437 N/A INTRINSIC
LRR 443 466 2.33e2 SMART
LRR 514 536 2.03e1 SMART
LRR 537 559 2.61e1 SMART
Blast:LRR 561 588 6e-11 BLAST
transmembrane domain 630 652 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000205937
Predicted Effect probably damaging
Transcript: ENSMUST00000205956
AA Change: G442W

PolyPhen 2 Score 0.987 (Sensitivity: 0.73; Specificity: 0.96)
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 100.0%
  • 10x: 99.7%
  • 20x: 99.2%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a type I membrane protein which contains 20 leucine-rich repeats. Alterations in the chromosomal region 11q13-11q14 are involved in several pathologies. [provided by RefSeq, Jul 2008]
PHENOTYPE: Mice homozygous for a conditional allele activated in T cells exhibit reduced regulatory T cell ability to drive Th17 differentiation. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 41 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700113H08Rik T C 10: 87,230,311 S119P possibly damaging Het
Agtpbp1 T A 13: 59,514,152 I282F probably damaging Het
Armh1 A T 4: 117,214,228 M355K possibly damaging Het
BC067074 T G 13: 113,346,541 V1559G Het
Cep128 A T 12: 91,019,322 D1013E probably benign Het
Clock A T 5: 76,245,420 probably null Het
D630003M21Rik G A 2: 158,216,778 Q401* probably null Het
Dnah17 C A 11: 118,025,171 V4302L probably benign Het
Drc3 A G 11: 60,370,560 Y179C probably benign Het
Erbb3 T C 10: 128,574,449 T647A probably benign Het
Esrp2 T C 8: 106,134,276 T205A probably benign Het
Fbxw7 T C 3: 84,967,565 probably null Het
Fmn1 C T 2: 113,525,814 P965S unknown Het
Fndc7 C T 3: 108,870,663 V412M possibly damaging Het
G2e3 C A 12: 51,369,056 A525E probably damaging Het
Gcfc2 C T 6: 81,941,390 R354C probably damaging Het
Ggt1 T A 10: 75,585,674 N510K probably damaging Het
Gnas C T 2: 174,299,027 T389I unknown Het
Hapln3 C T 7: 79,117,373 R306H probably benign Het
Hydin T C 8: 110,593,812 L4496P possibly damaging Het
Iqgap2 T A 13: 95,731,444 I219L probably benign Het
Kcnj2 T C 11: 111,072,483 S234P probably benign Het
Lipf T A 19: 33,973,065 S286T probably damaging Het
Megf10 GGCAGCAACAGCACCAGCAGCAACAGCACCAGCAGCA GGCAGCAACAGCACCAGCAGCA 18: 57,293,999 probably benign Het
Mtmr4 T C 11: 87,597,724 V68A probably damaging Het
Mug2 T C 6: 122,078,795 S1146P possibly damaging Het
Naa35 T C 13: 59,598,105 I75T probably benign Het
Nepn T A 10: 52,401,178 F337I probably benign Het
Nf1 A G 11: 79,425,606 M496V probably benign Het
Nthl1 A T 17: 24,638,657 I277F possibly damaging Het
Olfr1208 T C 2: 88,897,778 probably benign Het
Olfr518 A C 7: 108,880,682 I308S probably damaging Het
Osr1 A T 12: 9,579,253 Y42F probably damaging Het
Rad54l2 G A 9: 106,717,223 R369W probably damaging Het
Ryr3 T A 2: 112,635,346 T4828S probably benign Het
Slc25a54 T A 3: 109,102,817 C211S probably damaging Het
Ube4b C T 4: 149,398,781 R10Q possibly damaging Het
Usp9y G A Y: 1,304,411 Q2440* probably null Het
Yars G T 4: 129,210,498 V312L probably benign Het
Zfp26 G A 9: 20,441,334 T145I probably benign Het
Zic5 T C 14: 122,464,113 N402S unknown Het
Other mutations in Lrrc32
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01447:Lrrc32 APN 7 98498376 missense probably damaging 1.00
IGL01484:Lrrc32 APN 7 98494235 missense probably damaging 0.99
IGL01608:Lrrc32 APN 7 98499357 missense probably benign 0.01
IGL02025:Lrrc32 APN 7 98499560 missense probably benign 0.00
IGL02026:Lrrc32 APN 7 98499560 missense probably benign 0.00
IGL03061:Lrrc32 APN 7 98499422 missense probably benign 0.04
IGL03191:Lrrc32 APN 7 98498247 missense possibly damaging 0.66
R0706:Lrrc32 UTSW 7 98499710 missense probably damaging 1.00
R0947:Lrrc32 UTSW 7 98498883 missense probably benign
R1470:Lrrc32 UTSW 7 98499357 missense probably benign
R1470:Lrrc32 UTSW 7 98499357 missense probably benign
R2879:Lrrc32 UTSW 7 98499777 missense probably benign 0.02
R3608:Lrrc32 UTSW 7 98499186 missense probably benign 0.09
R4417:Lrrc32 UTSW 7 98498937 missense probably benign 0.01
R4798:Lrrc32 UTSW 7 98499017 missense probably damaging 1.00
R4872:Lrrc32 UTSW 7 98498520 missense probably damaging 0.99
R5813:Lrrc32 UTSW 7 98498411 missense probably damaging 1.00
R6062:Lrrc32 UTSW 7 98498541 missense probably benign 0.00
R6742:Lrrc32 UTSW 7 98498832 missense probably benign 0.00
R6930:Lrrc32 UTSW 7 98499264 missense possibly damaging 0.89
R7265:Lrrc32 UTSW 7 98499437 missense probably damaging 1.00
R7367:Lrrc32 UTSW 7 98498879 nonsense probably null
R7372:Lrrc32 UTSW 7 98499807 missense probably benign 0.28
R7414:Lrrc32 UTSW 7 98499994 missense probably benign 0.01
R7485:Lrrc32 UTSW 7 98498207 missense possibly damaging 0.94
R7679:Lrrc32 UTSW 7 98499687 missense possibly damaging 0.91
Z1088:Lrrc32 UTSW 7 98499060 missense probably benign 0.03
Predicted Primers PCR Primer
(F):5'- TGGACTTGAGCCACAATGTGC -3'
(R):5'- TTGCCTTGAAGCTCCAGTACC -3'

Sequencing Primer
(F):5'- CTTGAGCCACAATGTGCTGGAAG -3'
(R):5'- TGAAGCTCCAGTACCTCTAAGGATG -3'
Posted On2019-11-12