Incidental Mutation 'R7718:Ppargc1a'
ID595026
Institutional Source Beutler Lab
Gene Symbol Ppargc1a
Ensembl Gene ENSMUSG00000029167
Gene Nameperoxisome proliferative activated receptor, gamma, coactivator 1 alpha
SynonymsA830037N07Rik, Gm11133, Pgco1, Pgc1, PPAR Gamma Coactivator-1, Pgc-1alpha, Pgc-1alphaa
Accession Numbers
Is this an essential gene? Possibly essential (E-score: 0.690) question?
Stock #R7718 (G1)
Quality Score225.009
Status Not validated
Chromosome5
Chromosomal Location51454250-51567726 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) C to T at 51498162 bp
ZygosityHeterozygous
Amino Acid Change Valine to Methionine at position 99 (V99M)
Ref Sequence ENSEMBL: ENSMUSP00000117040 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000031059] [ENSMUST00000127135] [ENSMUST00000132734] [ENSMUST00000151104] [ENSMUST00000196968]
PDB Structure
SF-1 LBD bound by phosphatidylcholine [X-RAY DIFFRACTION]
Predicted Effect probably damaging
Transcript: ENSMUST00000031059
AA Change: V99M

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000138397
Gene: ENSMUSG00000029167
AA Change: V99M

DomainStartEndE-ValueType
low complexity region 23 40 N/A INTRINSIC
low complexity region 141 147 N/A INTRINSIC
PDB:3D24|D 197 218 1e-7 PDB
Predicted Effect probably damaging
Transcript: ENSMUST00000127135
AA Change: V95M

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000115586
Gene: ENSMUSG00000029167
AA Change: V95M

DomainStartEndE-ValueType
low complexity region 10 27 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000132734
AA Change: V99M

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000117040
Gene: ENSMUSG00000029167
AA Change: V99M

DomainStartEndE-ValueType
low complexity region 23 40 N/A INTRINSIC
low complexity region 141 147 N/A INTRINSIC
PDB:3D24|D 197 218 4e-7 PDB
low complexity region 294 300 N/A INTRINSIC
low complexity region 558 613 N/A INTRINSIC
low complexity region 615 636 N/A INTRINSIC
RRM 677 746 4.61e-5 SMART
Predicted Effect probably damaging
Transcript: ENSMUST00000151104
AA Change: V95M

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000116566
Gene: ENSMUSG00000029167
AA Change: V95M

DomainStartEndE-ValueType
low complexity region 19 36 N/A INTRINSIC
low complexity region 137 143 N/A INTRINSIC
PDB:3D24|D 193 214 1e-7 PDB
Predicted Effect probably damaging
Transcript: ENSMUST00000196968
AA Change: V99M

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000143553
Gene: ENSMUSG00000029167
AA Change: V99M

DomainStartEndE-ValueType
low complexity region 23 40 N/A INTRINSIC
low complexity region 141 147 N/A INTRINSIC
PDB:3D24|D 197 218 4e-7 PDB
low complexity region 294 300 N/A INTRINSIC
low complexity region 558 613 N/A INTRINSIC
low complexity region 615 636 N/A INTRINSIC
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.7%
  • 20x: 99.1%
Validation Efficiency
MGI Phenotype FUNCTION: This gene encodes a transcriptional coactivator that induces and coordinates gene expression regulating mitochondrial biogenesis, respiration, hepatic gluconeogenesis, thermogenic program in brown fat and muscle fiber-type switching. Mice lacking the encoded protein exhibit reduced thermogenic capacity, hyperactivity and resistance to diet-induced obesity. Mice lacking the encoded protein specifically in the heart exhibit peripartum cardiomyopathy. Alternative splicing results in multiple transcript variants. [provided by RefSeq, Sep 2015]
PHENOTYPE: Homozygous null mice display partial postnatal lethality, abnormal glucose and insulin homeostasis, resistance to diet induced obesity, increased oxygen consumption, spongiform encephalopathy, hyperactivity, increased startle reflex, and limb grasping. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 75 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
9530053A07Rik T C 7: 28,147,201 F1106S probably damaging Het
A430033K04Rik A T 5: 138,647,860 H669L possibly damaging Het
A930017K11Rik T A 17: 25,947,024 R430* probably null Het
Abcb1a A T 5: 8,715,788 N700I probably damaging Het
Abcc6 T C 7: 45,977,392 K1414E possibly damaging Het
Adcy5 T C 16: 35,280,415 V779A probably benign Het
Agap2 A G 10: 127,079,865 S82G possibly damaging Het
Aldh1l1 A G 6: 90,598,323 N864S probably damaging Het
Ang2 A T 14: 51,195,760 V55E probably benign Het
Ank2 A G 3: 126,965,013 M179T possibly damaging Het
Atrnl1 T A 19: 57,740,183 C1090* probably null Het
Atxn1l A G 8: 109,733,234 L132P probably damaging Het
Bptf A G 11: 107,081,456 V862A possibly damaging Het
Capn11 C A 17: 45,643,781 K143N probably damaging Het
Card6 A G 15: 5,099,787 V709A possibly damaging Het
Cavin4 C T 4: 48,671,984 A143V probably benign Het
Cntn5 A G 9: 9,984,128 I160T probably benign Het
Cyp2c40 T A 19: 39,767,338 N511Y probably benign Het
Dsc2 A T 18: 20,041,778 I480N probably damaging Het
Enoph1 T C 5: 100,062,160 V133A possibly damaging Het
Ezh2 A T 6: 47,554,191 D186E probably benign Het
Fam196b T C 11: 34,402,539 S194P probably benign Het
Gfra1 T C 19: 58,453,457 D14G possibly damaging Het
Gm9573 T C 17: 35,622,836 T153A unknown Het
Gmip C T 8: 69,817,733 R698W probably damaging Het
Grk4 A G 5: 34,694,816 N135D probably benign Het
Hspb6 A G 7: 30,554,347 D95G probably benign Het
Htatip2 T G 7: 49,770,884 H159Q possibly damaging Het
Igfn1 T C 1: 135,969,036 E1264G probably benign Het
Katnb1 T A 8: 95,095,208 V223E possibly damaging Het
Klra6 AGG AG 6: 130,013,352 probably null Het
Masp2 C T 4: 148,602,747 R29C probably damaging Het
Mcm3 A T 1: 20,817,274 C123* probably null Het
Mdn1 T C 4: 32,718,420 V2225A probably damaging Het
Me1 A G 9: 86,679,900 L44S probably damaging Het
Mlxip A G 5: 123,445,514 N380S probably benign Het
Myh14 C T 7: 44,661,040 V140I probably damaging Het
Myocd A T 11: 65,218,626 D106E probably damaging Het
Oat T C 7: 132,558,259 I411V probably benign Het
Olfr1085 A G 2: 86,658,029 V143A probably benign Het
Olfr483 T C 7: 108,103,648 V113A probably benign Het
Olfr715 A T 7: 107,128,718 V225D probably damaging Het
Orc2 A T 1: 58,480,317 H246Q possibly damaging Het
Pank4 A G 4: 154,974,643 E411G probably damaging Het
Pcdhb15 A G 18: 37,475,163 N483D probably damaging Het
Pcdhb20 A G 18: 37,505,651 D410G probably damaging Het
Pdcl2 A G 5: 76,317,999 C125R probably damaging Het
Peli3 C G 19: 4,934,556 probably null Het
Pkd1 A G 17: 24,586,500 D3313G probably benign Het
Plec A C 15: 76,177,439 M2766R probably damaging Het
Psg19 G A 7: 18,792,443 A374V probably benign Het
Psmd7 A T 8: 107,586,629 F54L possibly damaging Het
Ptbp2 C T 3: 119,720,988 G397R probably null Het
Ranbp3 A G 17: 56,696,718 D39G probably damaging Het
Rcor3 T C 1: 192,101,721 T406A probably benign Het
Rhbdl2 T A 4: 123,824,919 I222K probably damaging Het
Ripk2 T C 4: 16,151,968 N197S possibly damaging Het
Rpia A T 6: 70,766,618 M283K probably damaging Het
Rps6kc1 T C 1: 190,871,825 D200G probably benign Het
Sipa1l1 A T 12: 82,342,497 K499M probably damaging Het
Slc5a4b A G 10: 76,070,573 L404P probably damaging Het
Son AGAACCCCCAGCCGCAGGAGCCGAACCCCCAGCCGCAGGAGCCGAACCCCCAGCCGCAGGAGCCGAACCCCCAGCCG AGAACCCCCAGCCGCAGGAGCCGAACCCCCAGCCGCAGGAGCCGAACCCCCAGCCG 16: 91,660,334 probably benign Het
St7 A C 6: 17,854,999 T312P probably damaging Het
Strbp T C 2: 37,625,282 E244G probably damaging Het
Tbc1d8 T G 1: 39,376,980 T871P probably benign Het
Tcp1 T A 17: 12,922,162 I286N probably damaging Het
Tead3 C A 17: 28,333,517 V327F probably damaging Het
Tmem132c A T 5: 127,563,440 T892S probably benign Het
Trmt2a T C 16: 18,250,623 S65P probably benign Het
Ubp1 A G 9: 113,973,529 N479S possibly damaging Het
Ubtfl1 A T 9: 18,409,231 L18F possibly damaging Het
Uevld T G 7: 46,938,056 M299L probably benign Het
Unc13b T A 4: 43,173,854 Y1561N unknown Het
Ylpm1 A G 12: 85,029,122 K874E probably damaging Het
Zbtb37 G A 1: 161,032,232 R168W possibly damaging Het
Other mutations in Ppargc1a
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01016:Ppargc1a APN 5 51498031 splice site probably null
IGL01063:Ppargc1a APN 5 51474322 missense probably benign 0.43
IGL01800:Ppargc1a APN 5 51494721 missense probably damaging 1.00
IGL02179:Ppargc1a APN 5 51473711 missense possibly damaging 0.90
IGL02336:Ppargc1a APN 5 51495726 nonsense probably null
IGL02368:Ppargc1a APN 5 51474156 missense probably benign 0.05
R1300:Ppargc1a UTSW 5 51548672 missense probably damaging 1.00
R2048:Ppargc1a UTSW 5 51548516 missense probably damaging 1.00
R2054:Ppargc1a UTSW 5 51473788 missense possibly damaging 0.47
R2211:Ppargc1a UTSW 5 51474259 missense possibly damaging 0.47
R2848:Ppargc1a UTSW 5 51473809 missense probably benign 0.02
R4094:Ppargc1a UTSW 5 51490064 missense possibly damaging 0.47
R4419:Ppargc1a UTSW 5 51494702 missense probably damaging 1.00
R4552:Ppargc1a UTSW 5 51463215 intron probably benign
R4702:Ppargc1a UTSW 5 51495696 missense possibly damaging 0.73
R4855:Ppargc1a UTSW 5 51474222 missense possibly damaging 0.89
R5287:Ppargc1a UTSW 5 51462825 intron probably benign
R5313:Ppargc1a UTSW 5 51458239 utr 3 prime probably benign
R5403:Ppargc1a UTSW 5 51462825 intron probably benign
R5711:Ppargc1a UTSW 5 51474220 missense probably damaging 1.00
R5918:Ppargc1a UTSW 5 51463237 intron probably benign
R5940:Ppargc1a UTSW 5 51473911 missense probably damaging 1.00
R6170:Ppargc1a UTSW 5 51473911 missense probably damaging 1.00
R6415:Ppargc1a UTSW 5 51462834 intron probably benign
R7755:Ppargc1a UTSW 5 51473541 missense unknown
R7793:Ppargc1a UTSW 5 51462509 intron probably null
R7849:Ppargc1a UTSW 5 51548513 missense probably benign 0.45
R7932:Ppargc1a UTSW 5 51548513 missense probably benign 0.45
X0019:Ppargc1a UTSW 5 51548678 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- TTCCTACGCCACGGTTATGC -3'
(R):5'- TGGGCACTGAAGATTTCTCATAC -3'

Sequencing Primer
(F):5'- CCACGGTTATGCACTGGGAAG -3'
(R):5'- ATACAGTTTCCTCACCAGCCTGG -3'
Posted On2019-11-12