Incidental Mutation 'RF029:Hic1'
ID 604283
Institutional Source Beutler Lab
Gene Symbol Hic1
Ensembl Gene ENSMUSG00000043099
Gene Name hypermethylated in cancer 1
Synonyms HIC-1
Accession Numbers
Is this an essential gene? Possibly non essential (E-score: 0.379) question?
Stock # RF029 (G1)
Quality Score 116.474
Status Not validated
Chromosome 11
Chromosomal Location 75164565-75169519 bp(-) (GRCm38)
Type of Mutation small deletion (1 aa in frame mutation)
DNA Base Change (assembly) CGGGGGGGGGG to CGGGGGGG at 75169442 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change
Ref Sequence ENSEMBL: ENSMUSP00000053483 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000055619]
AlphaFold no structure available at present
Predicted Effect probably benign
Transcript: ENSMUST00000055619
SMART Domains Protein: ENSMUSP00000053483
Gene: ENSMUSG00000043099

low complexity region 71 81 N/A INTRINSIC
low complexity region 192 200 N/A INTRINSIC
BTB 207 313 6.94e-24 SMART
low complexity region 318 340 N/A INTRINSIC
low complexity region 350 370 N/A INTRINSIC
Blast:BTB 375 398 1e-7 BLAST
low complexity region 415 437 N/A INTRINSIC
low complexity region 442 453 N/A INTRINSIC
low complexity region 464 486 N/A INTRINSIC
low complexity region 519 542 N/A INTRINSIC
ZnF_C2H2 597 619 1.08e-1 SMART
ZnF_C2H2 667 689 1.18e-2 SMART
ZnF_C2H2 695 717 9.36e-6 SMART
ZnF_C2H2 723 745 4.54e-4 SMART
ZnF_C2H2 751 773 5.21e-4 SMART
low complexity region 774 804 N/A INTRINSIC
Coding Region Coverage
  • 1x: 99.8%
  • 3x: 99.7%
  • 10x: 99.2%
  • 20x: 98.3%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene functions as a growth regulatory and tumor repressor gene. Hypermethylation or deletion of the region of this gene have been associated with tumors and the contiguous-gene syndrome, Miller-Dieker syndrome. Alternative splicing of this gene results in multiple transcript variants. [provided by RefSeq, Sep 2010]
PHENOTYPE: Homozygotes for a targeted null mutation exhibit varying abnormalities, such as acrania, exencephaly, cleft palate, limb defects, and omphalocele, and die perinatally. Heterozygotes develop tumors, including lymphomas, sarcomas, and epithelial cancers. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 36 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abca17 T TCCCTC 17: 24,287,727 probably benign Het
Amot GGAGCAGCAA G X: 145,450,988 probably benign Het
C1s1 CCCATGGCTC CC 6: 124,541,351 probably null Het
Cacna1a CCA CCAACA 8: 84,638,724 probably benign Het
Ccdc170 ACC ACCGCC 10: 4,561,026 probably benign Het
Cyb5r4 CAGA CAGAGACACTGACCAGGGATGTGATAGA 9: 87,040,430 probably benign Het
Cyb5r4 CCAGGGA CCAGGGATGTGACAGACACACTGCACAGGGA 9: 87,040,442 probably benign Het
Defb22 GCGGCA GCGGCAGAGCTGGCCTTTGCGGCA 2: 152,485,833 probably benign Het
Eed C A 7: 89,955,032 A411S probably benign Het
Exd2 CCACAGC CC 12: 80,475,946 probably null Het
Fam171b GCAGC GCAGCATCAGC 2: 83,812,892 probably benign Het
Fbrsl1 GCGTGTGCTGGT GCGTGTGCTGGTTCGTGTGCTGGT 5: 110,378,139 probably benign Het
Gabre GGCTC GGCTCCTGCTC X: 72,270,059 probably benign Het
Gm47955 G GTTGTGGCTT 1: 82,960,527 probably benign Het
Gm572 TGGGGGGGGGGGG TGGGGG 4: 148,671,393 probably null Het
Ifi208 AGATG AG 1: 173,677,696 probably benign Het
Il2 GTGG GTGGGGCTTGAACTGG 3: 37,125,827 probably benign Het
Lkaaear1 CCAGCTCCAGCT CCAGCTCCAGCTACAGCTCCAGCT 2: 181,697,588 probably benign Het
Lrmp TG TGAGCACATGG 6: 145,173,790 probably benign Het
Rasa2 CGC CGCAGC 9: 96,631,467 probably benign Het
Reep1 CGCCA CGCCAGCCA 6: 71,707,966 probably null Het
Tcof1 CAG CAGAAG 18: 60,835,735 probably benign Het
Tcof1 AGC AGCGGC 18: 60,835,745 probably benign Het
Trappc9 GCTGCTGCT GCTGCTGCTGCTGCTTCTGCTGCT 15: 72,801,323 probably benign Het
Zfhx3 CAGCAACAG CAGCAACAGAAGCAACAG 8: 108,956,092 probably benign Het
Znrd1as CG CCACCACCACCACCCCCCCCAGG 17: 36,965,071 probably benign Het
Other mutations in Hic1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01110:Hic1 APN 11 75165519 missense possibly damaging 0.96
cough UTSW 11 75166317 missense possibly damaging 0.93
Cup UTSW 11 75167374 missense probably damaging 0.97
Undulate UTSW 11 75166216 missense possibly damaging 0.96
R0138:Hic1 UTSW 11 75167343 missense probably damaging 0.99
R0331:Hic1 UTSW 11 75165490 missense possibly damaging 0.53
R0491:Hic1 UTSW 11 75166310 missense possibly damaging 0.86
R0521:Hic1 UTSW 11 75166887 missense possibly damaging 0.68
R0744:Hic1 UTSW 11 75165801 missense possibly damaging 0.52
R1766:Hic1 UTSW 11 75165794 nonsense probably null
R2070:Hic1 UTSW 11 75169059 missense possibly damaging 0.68
R2211:Hic1 UTSW 11 75169384 missense possibly damaging 0.59
R5418:Hic1 UTSW 11 75166599 splice site probably null
R6047:Hic1 UTSW 11 75166849 missense possibly damaging 0.94
R6076:Hic1 UTSW 11 75167328 missense probably damaging 1.00
R6415:Hic1 UTSW 11 75166317 missense possibly damaging 0.93
R6633:Hic1 UTSW 11 75169498 missense unknown
R7122:Hic1 UTSW 11 75169230 missense probably benign
R7308:Hic1 UTSW 11 75167151 missense probably damaging 1.00
R7761:Hic1 UTSW 11 75167374 missense probably damaging 0.97
R7778:Hic1 UTSW 11 75166216 missense possibly damaging 0.96
R7824:Hic1 UTSW 11 75166216 missense possibly damaging 0.96
R8230:Hic1 UTSW 11 75165585 missense possibly damaging 0.85
R8419:Hic1 UTSW 11 75166270 missense possibly damaging 0.96
R8752:Hic1 UTSW 11 75169380 missense probably benign 0.00
R8832:Hic1 UTSW 11 75166902 missense possibly damaging 0.86
R8857:Hic1 UTSW 11 75165402 missense probably benign 0.33
R9068:Hic1 UTSW 11 75169506 missense unknown
R9157:Hic1 UTSW 11 75166227 missense possibly damaging 0.96
R9497:Hic1 UTSW 11 75169305 missense possibly damaging 0.92
R9594:Hic1 UTSW 11 75165931 missense possibly damaging 0.71
RF043:Hic1 UTSW 11 75169455 small deletion probably benign
Z1186:Hic1 UTSW 11 75167526 missense probably damaging 0.99
Z1187:Hic1 UTSW 11 75167526 missense probably damaging 0.99
Z1188:Hic1 UTSW 11 75167526 missense probably damaging 0.99
Z1189:Hic1 UTSW 11 75167526 missense probably damaging 0.99
Z1190:Hic1 UTSW 11 75167526 missense probably damaging 0.99
Z1191:Hic1 UTSW 11 75167526 missense probably damaging 0.99
Z1191:Hic1 UTSW 11 75169448 frame shift probably null
Z1191:Hic1 UTSW 11 75169449 frame shift probably null
Z1191:Hic1 UTSW 11 75169450 small deletion probably benign
Z1192:Hic1 UTSW 11 75167526 missense probably damaging 0.99
Z1192:Hic1 UTSW 11 75169450 small deletion probably benign
Predicted Primers PCR Primer

Sequencing Primer
Posted On 2019-12-04