Mutagenetix > Incidental Mutation

Incidental Mutation 'R6717:Mast1'

529439

Institutional Source

Beutler Lab

Gene Symbol

Mast1

Ensembl Gene

ENSMUSG00000053693

Gene Name

microtubule associated serine/threonine kinase 1

Synonyms

SAST170, SAST, 9430008B02Rik

MMRRC Submission

Accession Numbers

Essential gene?

Non essential (E-score: 0.000) question?

Stock #

R6717 (G1)

Quality Score

221.009

Status

Validated

Chromosome

Chromosomal Location

84911903-84937359 bp(-) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

T to C at 84917754 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Threonine to Alanine at position 849 (T849A)

Ref Sequence

ENSEMBL: ENSMUSP00000105363 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000109741] [ENSMUST00000119820]

AlphaFold

Q9R1L5

Predicted Effect

probably benign
Transcript: ENSMUST00000109741
AA Change: T849A

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)

SMART Domains

Protein: ENSMUSP00000105363
Gene: ENSMUSG00000053693
AA Change: T849A

Domain	Start	End	E-Value	Type
Pfam:DUF1908	61	337	1.4e-136	PFAM
S_TKc	376	649	4.07e-97	SMART
S_TK_X	650	710	6.23e-2	SMART
low complexity region	820	836	N/A	INTRINSIC
low complexity region	863	878	N/A	INTRINSIC
low complexity region	933	961	N/A	INTRINSIC
PDZ	977	1057	3.49e-14	SMART
low complexity region	1104	1132	N/A	INTRINSIC
low complexity region	1149	1174	N/A	INTRINSIC
low complexity region	1212	1224	N/A	INTRINSIC
low complexity region	1243	1252	N/A	INTRINSIC
low complexity region	1479	1492	N/A	INTRINSIC
low complexity region	1519	1535	N/A	INTRINSIC

Predicted Effect

probably benign
Transcript: ENSMUST00000119820

SMART Domains

Protein: ENSMUSP00000113547
Gene: ENSMUSG00000053693

Domain	Start	End	E-Value	Type
Pfam:DUF1908	61	338	5.1e-148	PFAM
S_TKc	376	644	2.79e-86	SMART

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000128400

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000138221

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000148573

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000153000

Coding Region Coverage

1x: 99.9%
3x: 99.7%
10x: 98.7%
20x: 96.5%

Validation Efficiency

98% (47/48)

Allele List at MGI

Other mutations in this stock

Total: 48 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
Akap9	C	T	5: 4,064,086	L3122F	probably damaging	Het
Atp6v1b1	A	T	6: 83,753,650		probably null	Het
Ccdc178	A	T	18: 22,020,889	V621E	probably damaging	Het
Cfap126	T	C	1: 171,114,102		probably null	Het
Cog2	T	C	8: 124,525,749	I64T	probably damaging	Het
Dhx9	A	C	1: 153,473,464		probably null	Het
Efcab7	A	G	4: 99,904,734	D407G	possibly damaging	Het
Eif2b5	G	T	16: 20,505,283	G459C	probably damaging	Het
Eml5	T	C	12: 98,827,506	E1168G	probably damaging	Het
Flnc	AGCTGTCAAGTATGCTG	AGCTG	6: 29,450,902		probably benign	Het
Fry	A	G	5: 150,496,312	T980A	probably benign	Het
Gabbr2	A	G	4: 46,787,574	V363A	possibly damaging	Het
Ggt6	T	A	11: 72,437,520	L244*	probably null	Het
Gm13119	G	T	4: 144,362,657	V182L	probably benign	Het
Gprc6a	T	A	10: 51,615,137	I768F	probably damaging	Het
Grk1	G	A	8: 13,416,237	M560I	probably benign	Het
Hapln4	G	A	8: 70,085,090	E145K	probably damaging	Het
Hoxd9	C	T	2: 74,698,389	P112S	probably benign	Het
Ly6g6f	T	A	17: 35,085,574	M1L	probably benign	Het
Mob4	A	T	1: 55,136,713	M39L	possibly damaging	Het
Mrgpre	A	T	7: 143,781,523	L81Q	probably damaging	Het
Mst1	T	C	9: 108,080,575		probably null	Het
Muc5b	A	T	7: 141,857,822	R1502*	probably null	Het
Olfr1020	T	A	2: 85,850,223	I257N	probably damaging	Het
Olfr142	T	A	2: 90,252,524	I155L	probably benign	Het
Olfr311	T	C	11: 58,841,287	Y58H	probably damaging	Het
Pdc	A	G	1: 150,333,018	D84G	probably damaging	Het
Peak1	T	C	9: 56,207,239	N443D	probably benign	Het
Pkd1l3	T	A	8: 109,614,769	W85R	unknown	Het
Rfc1	G	A	5: 65,302,004	Q190*	probably null	Het
Rfc1	A	G	5: 65,312,961	S68P	probably damaging	Het
Rnf145	T	C	11: 44,561,490	V432A	probably benign	Het
Ror2	A	G	13: 53,118,982	S204P	probably damaging	Het
Scn1a	T	C	2: 66,332,287	E205G	probably damaging	Het
Slc2a8	A	C	2: 32,976,177	M277R	probably damaging	Het
Slc4a1	T	C	11: 102,354,423	Y566C	probably damaging	Het
Slc6a12	A	G	6: 121,354,303	N185S	probably benign	Het
Srcap	GCTCCTCCTCCTCCTCCT	GCTCCTCCTCCTCCT	7: 127,558,310		probably benign	Het
Stk33	T	A	7: 109,327,616	T279S	possibly damaging	Het
Taok3	A	G	5: 117,240,950		probably benign	Het
Tlr11	A	G	14: 50,362,104	T516A	probably benign	Het
Tmem132c	T	A	5: 127,564,029	L1088Q	possibly damaging	Het
Tmem132d	T	A	5: 127,784,421	M879L	probably benign	Het
Tnk2	A	G	16: 32,670,869	E322G	probably damaging	Het
Ttc28	T	C	5: 111,285,436	V2081A	probably benign	Het
Ttn	C	T	2: 76,794,409		probably null	Het
Zfp105	T	C	9: 122,930,308	V348A	possibly damaging	Het
Zswim2	T	C	2: 83,915,409	R562G	probably benign	Het

Other mutations in Mast1

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL01395:Mast1	APN	8	84912815	missense	possibly damaging	0.87
IGL01862:Mast1	APN	8	84913246	splice site	probably null
IGL01918:Mast1	APN	8	84921209	missense	probably damaging	1.00
IGL02212:Mast1	APN	8	84921397	missense	probably damaging	1.00
IGL02221:Mast1	APN	8	84918755	missense	possibly damaging	0.92
IGL02370:Mast1	APN	8	84912254	missense	probably benign
IGL02470:Mast1	APN	8	84921212	missense	probably damaging	1.00
IGL02596:Mast1	APN	8	84917771	missense	probably benign
IGL02716:Mast1	APN	8	84935723	missense	probably damaging	1.00
IGL02987:Mast1	APN	8	84925719	missense	possibly damaging	0.75
IGL03287:Mast1	APN	8	84913353	missense	probably benign	0.01
R0255:Mast1	UTSW	8	84912021	missense	probably benign
R0388:Mast1	UTSW	8	84915537	missense	probably benign	0.13
R0480:Mast1	UTSW	8	84913089	missense	probably damaging	0.99
R0727:Mast1	UTSW	8	84921415	missense	probably damaging	1.00
R1175:Mast1	UTSW	8	84925327	missense	probably benign	0.29
R1297:Mast1	UTSW	8	84912716	missense	probably benign	0.05
R1328:Mast1	UTSW	8	84917988	intron	probably benign
R1454:Mast1	UTSW	8	84920635	missense	probably damaging	1.00
R1532:Mast1	UTSW	8	84928609	nonsense	probably null
R1752:Mast1	UTSW	8	84925336	missense	probably benign
R1777:Mast1	UTSW	8	84912068	missense	probably benign
R1905:Mast1	UTSW	8	84916266	missense	probably damaging	1.00
R1906:Mast1	UTSW	8	84916266	missense	probably damaging	1.00
R1907:Mast1	UTSW	8	84916266	missense	probably damaging	1.00
R2056:Mast1	UTSW	8	84920366	missense	possibly damaging	0.95
R2071:Mast1	UTSW	8	84921194	missense	probably damaging	1.00
R2145:Mast1	UTSW	8	84921478	missense	probably damaging	1.00
R2318:Mast1	UTSW	8	84921125	missense	probably damaging	1.00
R2842:Mast1	UTSW	8	84923908	missense	probably damaging	1.00
R3870:Mast1	UTSW	8	84918731	missense	probably damaging	1.00
R3895:Mast1	UTSW	8	84935723	missense	probably damaging	1.00
R3973:Mast1	UTSW	8	84918764	missense	probably damaging	1.00
R4405:Mast1	UTSW	8	84920891	missense	probably damaging	1.00
R4533:Mast1	UTSW	8	84921361	missense	probably damaging	1.00
R4725:Mast1	UTSW	8	84929006	missense	possibly damaging	0.93
R4770:Mast1	UTSW	8	84929246	missense	probably benign	0.02
R4776:Mast1	UTSW	8	84937193	critical splice donor site	probably null
R4835:Mast1	UTSW	8	84923779	missense	probably damaging	1.00
R4871:Mast1	UTSW	8	84920658	missense	probably damaging	1.00
R4953:Mast1	UTSW	8	84918728	missense	probably damaging	0.99
R4960:Mast1	UTSW	8	84917871	missense	probably benign
R4978:Mast1	UTSW	8	84935787	missense	probably damaging	0.98
R5164:Mast1	UTSW	8	84913518	unclassified	probably benign
R5235:Mast1	UTSW	8	84913439	missense	probably damaging	1.00
R5297:Mast1	UTSW	8	84913318	critical splice donor site	probably null
R5463:Mast1	UTSW	8	84925507	missense	probably damaging	1.00
R5546:Mast1	UTSW	8	84916260	missense	probably damaging	1.00
R5651:Mast1	UTSW	8	84928968	nonsense	probably null
R6124:Mast1	UTSW	8	84925307	missense	probably benign	0.01
R6213:Mast1	UTSW	8	84915569	missense	probably damaging	1.00
R7000:Mast1	UTSW	8	84928969	missense	probably damaging	1.00
R7011:Mast1	UTSW	8	84911945	nonsense	probably null
R7164:Mast1	UTSW	8	84935304	missense	possibly damaging	0.81
R7695:Mast1	UTSW	8	84920928	missense	probably damaging	1.00
R7845:Mast1	UTSW	8	84925325	nonsense	probably null
R7882:Mast1	UTSW	8	84913318	critical splice donor site	probably null
R8167:Mast1	UTSW	8	84921358	missense	probably damaging	1.00
R8197:Mast1	UTSW	8	84912821	missense	possibly damaging	0.90
R8773:Mast1	UTSW	8	84916324	missense	probably damaging	1.00
R9477:Mast1	UTSW	8	84912150	missense	probably benign	0.18
R9526:Mast1	UTSW	8	84921176	missense	probably damaging	1.00
R9557:Mast1	UTSW	8	84930845	missense	probably damaging	1.00
R9655:Mast1	UTSW	8	84924031	missense	probably damaging	1.00
X0066:Mast1	UTSW	8	84920878	missense	probably damaging	1.00
Z1176:Mast1	UTSW	8	84912459	missense	probably damaging	0.97
Z1176:Mast1	UTSW	8	84918681	missense	probably damaging	1.00
Z1177:Mast1	UTSW	8	84920446	missense	probably benign	0.09

Predicted Primers

PCR Primer
(F):5'- GCAGACGTTCTCGGTGGTAA -3'
(R):5'- TGATCTGGTTTTCTCCATGCAGTA -3'

Sequencing Primer
(F):5'- AGACGTTCTCGGTGGTAATACTCAC -3'
(R):5'- TTCTCAGCGTCTGAAGCCAG -3'

Posted On

2018-08-01