Incidental Mutation 'R8011:Pdk1'
ID616891
Institutional Source Beutler Lab
Gene Symbol Pdk1
Ensembl Gene ENSMUSG00000006494
Gene Namepyruvate dehydrogenase kinase, isoenzyme 1
Synonyms
MMRRC Submission
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R8011 (G1)
Quality Score225.009
Status Validated
Chromosome2
Chromosomal Location71873224-71903858 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to T at 71875452 bp
ZygosityHeterozygous
Amino Acid Change Glutamine to Histidine at position 81 (Q81H)
Ref Sequence ENSEMBL: ENSMUSP00000006669 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000006669]
Predicted Effect probably benign
Transcript: ENSMUST00000006669
AA Change: Q81H

PolyPhen 2 Score 0.045 (Sensitivity: 0.94; Specificity: 0.83)
SMART Domains Protein: ENSMUSP00000006669
Gene: ENSMUSG00000006494
AA Change: Q81H

DomainStartEndE-ValueType
low complexity region 22 38 N/A INTRINSIC
Pfam:BCDHK_Adom3 56 218 6.4e-52 PFAM
HATPase_c 266 391 1.82e-16 SMART
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 100.0%
  • 10x: 99.8%
  • 20x: 99.4%
Validation Efficiency 100% (46/46)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] Pyruvate dehydrogenase (PDH) is a mitochondrial multienzyme complex that catalyzes the oxidative decarboxylation of pyruvate and is one of the major enzymes responsible for the regulation of homeostasis of carbohydrate fuels in mammals. The enzymatic activity is regulated by a phosphorylation/dephosphorylation cycle. Phosphorylation of PDH by a specific pyruvate dehydrogenase kinase (PDK) results in inactivation. Multiple alternatively spliced transcript variants have been found for this gene. [provided by RefSeq, Jun 2013]
Allele List at MGI
Other mutations in this stock
Total: 46 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2010315B03Rik C T 9: 124,293,899 E132K Het
Acss2 T C 2: 155,555,957 I313T possibly damaging Het
Akap13 G A 7: 75,730,465 R462H probably damaging Het
Ankrd27 T C 7: 35,616,881 V524A probably benign Het
Cacna1e T C 1: 154,465,822 I1209V probably benign Het
Cntn3 A T 6: 102,437,899 I29N possibly damaging Het
Col5a1 G A 2: 27,980,521 probably benign Het
Cttnbp2 G C 6: 18,426,093 A762G possibly damaging Het
Edc3 C A 9: 57,713,376 probably benign Het
Egflam A T 15: 7,247,044 M547K possibly damaging Het
Fgr T C 4: 132,998,479 Y400H probably damaging Het
Gaa C T 11: 119,272,936 P205S probably benign Het
Gm14139 A G 2: 150,192,346 S196G possibly damaging Het
Gpr6 T A 10: 41,070,915 T224S probably benign Het
Hes3 T C 4: 152,287,481 probably benign Het
Hydin T C 8: 110,583,909 F4079S probably damaging Het
Igf2bp2 A T 16: 22,076,099 I366N probably damaging Het
Kmt2c A G 5: 25,351,234 V1171A probably damaging Het
Kndc1 T A 7: 139,910,620 F346Y possibly damaging Het
Lpin2 G A 17: 71,230,375 G306R probably benign Het
Mok T C 12: 110,814,917 probably benign Het
Nolc1 T C 19: 46,081,584 V265A unknown Het
Ogfr GGCCAGAGGACCCCAAAAGCCAGGTGGAGCCAGAGGACCCCAAAAGCCAGGTGGAGCCAGAGGACCCCAAAAGCCAGGTGGAGCCAGAGGACCCCAAAAGCCAGGTGGGGCCAGAGGACCCCCAAAGCCAGGTGG GGCCAGAGGACCCCAAAAGCCAGGTGGAGCCAGAGGACCCCAAAAGCCAGGTGGAGCCAGAGGACCCCAAAAGCCAGGTGGGGCCAGAGGACCCCCAAAGCCAGGTGG 2: 180,595,266 probably benign Het
Olfr1018 T G 2: 85,823,613 L214R possibly damaging Het
Olfr1106 A C 2: 87,048,846 L130R probably damaging Het
Olfr1195 G A 2: 88,683,193 Q180* probably null Het
Olfr1415 A G 1: 92,491,275 V160A possibly damaging Het
Parp14 G A 16: 35,856,634 T988I probably benign Het
Plekha6 A G 1: 133,263,806 T38A probably benign Het
Pou2f1 A G 1: 165,894,903 probably null Het
Rgs6 A G 12: 83,116,292 D424G probably null Het
Rnf13 T G 3: 57,807,070 Y183* probably null Het
Ryr2 A T 13: 11,588,140 probably null Het
Serpinb7 T A 1: 107,434,757 S64T possibly damaging Het
Six2 T C 17: 85,687,672 E94G probably damaging Het
Slc44a5 A G 3: 154,247,810 I276M possibly damaging Het
Smco2 A G 6: 146,868,135 Y239C probably damaging Het
Ssx2ip T C 3: 146,422,911 S148P probably damaging Het
Tiam2 T C 17: 3,448,396 Y816H possibly damaging Het
Tnk2 C T 16: 32,668,365 R127C probably benign Het
Tpd52l1 T C 10: 31,332,917 N185S probably benign Het
Try5 T C 6: 41,313,487 D21G probably benign Het
Vmn2r20 A G 6: 123,396,410 V491A possibly damaging Het
Vps54 G T 11: 21,275,095 R197L probably damaging Het
Xkr5 G T 8: 18,948,720 Y27* probably null Het
Zfp626 T A 7: 27,818,715 C374S possibly damaging Het
Other mutations in Pdk1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01409:Pdk1 APN 2 71895779 missense probably benign 0.00
IGL01643:Pdk1 APN 2 71897705 missense probably damaging 1.00
IGL02672:Pdk1 APN 2 71895752 missense probably damaging 1.00
IGL02833:Pdk1 APN 2 71897645 critical splice acceptor site probably null
IGL03271:Pdk1 APN 2 71880030 splice site probably benign
IGL03400:Pdk1 APN 2 71895747 missense probably benign 0.25
R0329:Pdk1 UTSW 2 71895674 splice site probably benign
R0564:Pdk1 UTSW 2 71880039 nonsense probably null
R1653:Pdk1 UTSW 2 71888995 critical splice donor site probably null
R2570:Pdk1 UTSW 2 71873560 missense possibly damaging 0.56
R5137:Pdk1 UTSW 2 71883569 missense possibly damaging 0.90
R5932:Pdk1 UTSW 2 71883416 splice site probably null
R6109:Pdk1 UTSW 2 71883506 missense probably benign 0.23
R7107:Pdk1 UTSW 2 71895741 missense probably benign 0.00
R7227:Pdk1 UTSW 2 71883901 missense possibly damaging 0.75
R7663:Pdk1 UTSW 2 71875398 splice site probably null
RF020:Pdk1 UTSW 2 71883896 missense possibly damaging 0.84
RF060:Pdk1 UTSW 2 71873445 small deletion probably benign
Predicted Primers PCR Primer
(F):5'- CGGTTAGTTCAACTGTGCCTGG -3'
(R):5'- CCACTGTAATTGTAAACACAAGATGGG -3'

Sequencing Primer
(F):5'- GTTCAACTGTGCCTGGATATATC -3'
(R):5'- CTTCAGAGTGAGTTCCAGGAC -3'
Posted On2020-01-23