Incidental Mutation 'R8110:Cyp2u1'
ID 630794
Institutional Source Beutler Lab
Gene Symbol Cyp2u1
Ensembl Gene ENSMUSG00000027983
Gene Name cytochrome P450, family 2, subfamily u, polypeptide 1
Synonyms
MMRRC Submission
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.154) question?
Stock # R8110 (G1)
Quality Score 225.009
Status Validated
Chromosome 3
Chromosomal Location 131288441-131303227 bp(-) (GRCm38)
Type of Mutation missense
DNA Base Change (assembly) G to A at 131293654 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change Threonine to Isoleucine at position 426 (T426I)
Ref Sequence ENSEMBL: ENSMUSP00000101944 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000106337] [ENSMUST00000200236]
AlphaFold Q9CX98
Predicted Effect probably damaging
Transcript: ENSMUST00000106337
AA Change: T426I

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000101944
Gene: ENSMUSG00000027983
AA Change: T426I

DomainStartEndE-ValueType
transmembrane domain 20 42 N/A INTRINSIC
Pfam:p450 69 527 4.2e-126 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000200236
AA Change: T426I

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000142519
Gene: ENSMUSG00000027983
AA Change: T426I

DomainStartEndE-ValueType
transmembrane domain 20 42 N/A INTRINSIC
Pfam:p450 69 473 1.1e-108 PFAM
transmembrane domain 476 498 N/A INTRINSIC
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.7%
  • 10x: 98.6%
  • 20x: 93.1%
Validation Efficiency 99% (73/74)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of the cytochrome P450 superfamily of enzymes. The cytochrome P450 proteins are monooxygenases which catalyze many reactions involved in drug metabolism and synthesis of cholesterol, steroids and other lipids. This enzyme is a hydroxylase that metabolizes arachidonic acid, docosahexaenoic acid, and other long chain fatty acids. [provided by RefSeq, Jul 2008]
Allele List at MGI
Other mutations in this stock
Total: 68 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
0610010F05Rik G T 11: 23,576,764 T696N probably benign Het
Ankrd45 T C 1: 161,151,319 probably null Het
Appl1 C A 14: 26,927,794 G592* probably null Het
Arfgef2 T A 2: 166,878,544 M1501K probably benign Het
Calcrl C T 2: 84,339,339 A333T probably damaging Het
Cd200r3 T A 16: 44,951,472 I33N probably benign Het
Ceacam15 A G 7: 16,673,409 L61P probably benign Het
Cfap69 T A 5: 5,582,515 H827L possibly damaging Het
Csmd3 T A 15: 47,644,270 E2780V probably damaging Het
Eefsec A C 6: 88,376,330 I119S probably damaging Het
Fem1b T C 9: 62,796,268 N570S probably damaging Het
Fmo9 A G 1: 166,663,526 M461T probably benign Het
Fryl A G 5: 73,133,277 Y95H probably benign Het
Fsip2 T C 2: 82,958,673 I346T probably benign Het
Fto T C 8: 91,485,190 F381S probably damaging Het
Gabbr1 G C 17: 37,048,583 S150T probably benign Het
Galnt9 G T 5: 110,615,473 W448L probably damaging Het
Gcnt2 G T 13: 40,917,722 probably benign Het
Gm10800 CAAGAAAACTGAAAATCAAAGAAAACTGAAAATCA CAAGAAAACTGAAAATCA 2: 98,667,016 probably null Het
Gm17727 T C 9: 35,778,033 *84W probably null Het
Gm8882 C T 6: 132,361,568 G229D unknown Het
Gmcl1 G T 6: 86,721,426 A163E probably damaging Het
Hectd4 A G 5: 121,332,949 Y2633C possibly damaging Het
Hsd11b2 A G 8: 105,522,634 I214V probably damaging Het
Hspa12a T A 19: 58,821,013 E217V possibly damaging Het
Itih2 A G 2: 10,097,137 F845L probably damaging Het
Kcnn3 T A 3: 89,661,233 L606H probably damaging Het
Krt6b G A 15: 101,680,142 R28C probably damaging Het
Lama2 T A 10: 26,990,870 D2876V probably damaging Het
Lmbrd2 T C 15: 9,175,192 S397P probably damaging Het
Lmf2 C T 15: 89,352,358 probably null Het
Lrp2 A G 2: 69,506,453 I1325T probably benign Het
Ltbp2 A T 12: 84,803,902 C879* probably null Het
Map3k1 A G 13: 111,755,313 V1136A probably damaging Het
Mettl3 G T 14: 52,300,252 H84N probably benign Het
Mia2 A G 12: 59,109,087 probably null Het
Mlip G T 9: 77,239,579 T92K probably damaging Het
Nalcn T A 14: 123,464,701 Y466F probably benign Het
Nav2 T A 7: 49,551,950 L235* probably null Het
Nbn T C 4: 15,981,588 V560A probably benign Het
Ncln A T 10: 81,493,153 Y144N possibly damaging Het
Nfe2l2 A C 2: 75,679,421 D18E probably benign Het
Olfr102 A G 17: 37,313,713 F224L probably benign Het
Olfr1131 T C 2: 87,628,607 I48T possibly damaging Het
Olfr356 T C 2: 36,937,709 C197R possibly damaging Het
Olfr432 G A 1: 174,050,525 A51T probably benign Het
Otop3 A T 11: 115,339,395 M33L probably benign Het
Pdzd2 G A 15: 12,373,506 S2181L probably benign Het
Phf14 T C 6: 11,953,423 I387T possibly damaging Het
Prdm9 T A 17: 15,554,698 N318Y probably damaging Het
Proca1 A G 11: 78,204,911 D123G probably damaging Het
Prune2 G A 19: 17,120,719 G1196S probably benign Het
Psd3 T A 8: 68,121,056 S158C probably damaging Het
Rps18 A G 17: 33,955,136 V15A probably benign Het
Sharpin C A 15: 76,347,765 R271L possibly damaging Het
Smad5 C A 13: 56,723,888 Q99K probably damaging Het
Sox5 T C 6: 144,116,474 M151V possibly damaging Het
Sphkap A T 1: 83,278,771 F419Y possibly damaging Het
Tbx20 T A 9: 24,725,525 Y422F probably damaging Het
Tcirg1 A C 19: 3,899,099 F397V probably damaging Het
Tex36 G A 7: 133,595,283 S35F possibly damaging Het
Tsen54 G T 11: 115,814,934 A26S unknown Het
Usp50 T A 2: 126,780,330 probably null Het
Vmn2r5 A T 3: 64,491,288 F757I probably benign Het
Zbbx T C 3: 75,155,442 T3A possibly damaging Het
Zfp28 T A 7: 6,389,829 M168K probably benign Het
Zfp568 G T 7: 30,023,126 G499W probably damaging Het
Zfp7 C G 15: 76,890,931 P391R possibly damaging Het
Other mutations in Cyp2u1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL02027:Cyp2u1 APN 3 131297951 missense probably damaging 1.00
IGL02365:Cyp2u1 APN 3 131298229 missense probably damaging 1.00
R0387:Cyp2u1 UTSW 3 131295552 splice site probably null
R0781:Cyp2u1 UTSW 3 131293609 missense possibly damaging 0.85
R1110:Cyp2u1 UTSW 3 131293609 missense possibly damaging 0.85
R1620:Cyp2u1 UTSW 3 131302701 missense probably damaging 0.98
R3087:Cyp2u1 UTSW 3 131303027 missense probably benign
R3845:Cyp2u1 UTSW 3 131293486 missense possibly damaging 0.66
R4996:Cyp2u1 UTSW 3 131298284 missense probably benign 0.00
R5913:Cyp2u1 UTSW 3 131303211 unclassified probably benign
R6815:Cyp2u1 UTSW 3 131298010 missense probably damaging 1.00
R6903:Cyp2u1 UTSW 3 131302775 missense probably benign 0.03
R6932:Cyp2u1 UTSW 3 131298296 missense possibly damaging 0.94
R7067:Cyp2u1 UTSW 3 131293553 missense probably damaging 1.00
R7167:Cyp2u1 UTSW 3 131303124 missense probably benign 0.23
R7193:Cyp2u1 UTSW 3 131291143 missense probably benign
R7262:Cyp2u1 UTSW 3 131297956 missense probably damaging 1.00
R7371:Cyp2u1 UTSW 3 131293495 missense probably benign 0.01
R7488:Cyp2u1 UTSW 3 131297947 missense probably damaging 1.00
R7605:Cyp2u1 UTSW 3 131297953 missense probably damaging 0.99
R7733:Cyp2u1 UTSW 3 131303027 missense probably benign 0.40
R8819:Cyp2u1 UTSW 3 131298367 missense probably damaging 1.00
R8820:Cyp2u1 UTSW 3 131298367 missense probably damaging 1.00
R8887:Cyp2u1 UTSW 3 131302854 missense probably damaging 0.98
R8919:Cyp2u1 UTSW 3 131295465 missense probably damaging 1.00
R9334:Cyp2u1 UTSW 3 131298416 missense probably damaging 0.99
R9377:Cyp2u1 UTSW 3 131297800 missense possibly damaging 0.94
Predicted Primers PCR Primer
(F):5'- TGAACCCGGTACCTACACTC -3'
(R):5'- GACAGGATCAGAGATCTTTGATAGG -3'

Sequencing Primer
(F):5'- TACACATCTCAAACATGCCTGTATAC -3'
(R):5'- TCAGAGATCTTTGATAGGATCTTGTC -3'
Posted On 2020-06-30