Incidental Mutation 'R8110:Fem1b'
ID 630815
Institutional Source Beutler Lab
Gene Symbol Fem1b
Ensembl Gene ENSMUSG00000032244
Gene Name feminization 1 homolog b (C. elegans)
Synonyms
MMRRC Submission 067539-MU
Accession Numbers
Essential gene? Non essential (E-score: 0.000) question?
Stock # R8110 (G1)
Quality Score 225.009
Status Validated
Chromosome 9
Chromosomal Location 62791821-62811934 bp(-) (GRCm38)
Type of Mutation missense
DNA Base Change (assembly) T to C at 62796268 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change Asparagine to Serine at position 570 (N570S)
Ref Sequence ENSEMBL: ENSMUSP00000034775 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000034775]
AlphaFold Q9Z2G0
Predicted Effect probably damaging
Transcript: ENSMUST00000034775
AA Change: N570S

PolyPhen 2 Score 0.996 (Sensitivity: 0.55; Specificity: 0.98)
SMART Domains Protein: ENSMUSP00000034775
Gene: ENSMUSG00000032244
AA Change: N570S

DomainStartEndE-ValueType
ANK 45 74 6.81e-3 SMART
ANK 87 116 6.65e-6 SMART
ANK 120 149 8.39e-3 SMART
ANK 153 182 8.91e-7 SMART
ANK 186 215 4.13e-2 SMART
ANK 218 246 6.71e-2 SMART
ANK 483 527 1.72e1 SMART
ANK 531 570 6.05e2 SMART
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.7%
  • 10x: 98.6%
  • 20x: 93.1%
Validation Efficiency 99% (73/74)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes an ankyrin repeat protein that belongs to the death receptor-associated family of proteins and plays a role in mediating apoptosis. The encoded protein is also thought to function in the replication stress-induced checkpoint signaling pathway via interaction with checkpoint kinase 1. [provided by RefSeq, Aug 2013]
PHENOTYPE: Homozygous targeted mutants display abnormal glucose tolerance due to defective glucose-stimulated insulin secretion. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 68 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
0610010F05Rik G T 11: 23,576,764 T696N probably benign Het
Ankrd45 T C 1: 161,151,319 probably null Het
Appl1 C A 14: 26,927,794 G592* probably null Het
Arfgef2 T A 2: 166,878,544 M1501K probably benign Het
Calcrl C T 2: 84,339,339 A333T probably damaging Het
Cd200r3 T A 16: 44,951,472 I33N probably benign Het
Ceacam15 A G 7: 16,673,409 L61P probably benign Het
Cfap69 T A 5: 5,582,515 H827L possibly damaging Het
Csmd3 T A 15: 47,644,270 E2780V probably damaging Het
Cyp2u1 G A 3: 131,293,654 T426I probably damaging Het
Eefsec A C 6: 88,376,330 I119S probably damaging Het
Fmo9 A G 1: 166,663,526 M461T probably benign Het
Fryl A G 5: 73,133,277 Y95H probably benign Het
Fsip2 T C 2: 82,958,673 I346T probably benign Het
Fto T C 8: 91,485,190 F381S probably damaging Het
Gabbr1 G C 17: 37,048,583 S150T probably benign Het
Galnt9 G T 5: 110,615,473 W448L probably damaging Het
Gcnt2 G T 13: 40,917,722 probably benign Het
Gm10800 CAAGAAAACTGAAAATCAAAGAAAACTGAAAATCA CAAGAAAACTGAAAATCA 2: 98,667,016 probably null Het
Gm17727 T C 9: 35,778,033 *84W probably null Het
Gm8882 C T 6: 132,361,568 G229D unknown Het
Gmcl1 G T 6: 86,721,426 A163E probably damaging Het
Hectd4 A G 5: 121,332,949 Y2633C possibly damaging Het
Hsd11b2 A G 8: 105,522,634 I214V probably damaging Het
Hspa12a T A 19: 58,821,013 E217V possibly damaging Het
Itih2 A G 2: 10,097,137 F845L probably damaging Het
Kcnn3 T A 3: 89,661,233 L606H probably damaging Het
Krt6b G A 15: 101,680,142 R28C probably damaging Het
Lama2 T A 10: 26,990,870 D2876V probably damaging Het
Lmbrd2 T C 15: 9,175,192 S397P probably damaging Het
Lmf2 C T 15: 89,352,358 probably null Het
Lrp2 A G 2: 69,506,453 I1325T probably benign Het
Ltbp2 A T 12: 84,803,902 C879* probably null Het
Map3k1 A G 13: 111,755,313 V1136A probably damaging Het
Mettl3 G T 14: 52,300,252 H84N probably benign Het
Mia2 A G 12: 59,109,087 probably null Het
Mlip G T 9: 77,239,579 T92K probably damaging Het
Nalcn T A 14: 123,464,701 Y466F probably benign Het
Nav2 T A 7: 49,551,950 L235* probably null Het
Nbn T C 4: 15,981,588 V560A probably benign Het
Ncln A T 10: 81,493,153 Y144N possibly damaging Het
Nfe2l2 A C 2: 75,679,421 D18E probably benign Het
Olfr102 A G 17: 37,313,713 F224L probably benign Het
Olfr1131 T C 2: 87,628,607 I48T possibly damaging Het
Olfr356 T C 2: 36,937,709 C197R possibly damaging Het
Olfr432 G A 1: 174,050,525 A51T probably benign Het
Otop3 A T 11: 115,339,395 M33L probably benign Het
Pdzd2 G A 15: 12,373,506 S2181L probably benign Het
Phf14 T C 6: 11,953,423 I387T possibly damaging Het
Prdm9 T A 17: 15,554,698 N318Y probably damaging Het
Proca1 A G 11: 78,204,911 D123G probably damaging Het
Prune2 G A 19: 17,120,719 G1196S probably benign Het
Psd3 T A 8: 68,121,056 S158C probably damaging Het
Rps18 A G 17: 33,955,136 V15A probably benign Het
Sharpin C A 15: 76,347,765 R271L possibly damaging Het
Smad5 C A 13: 56,723,888 Q99K probably damaging Het
Sox5 T C 6: 144,116,474 M151V possibly damaging Het
Sphkap A T 1: 83,278,771 F419Y possibly damaging Het
Tbx20 T A 9: 24,725,525 Y422F probably damaging Het
Tcirg1 A C 19: 3,899,099 F397V probably damaging Het
Tex36 G A 7: 133,595,283 S35F possibly damaging Het
Tsen54 G T 11: 115,814,934 A26S unknown Het
Usp50 T A 2: 126,780,330 probably null Het
Vmn2r5 A T 3: 64,491,288 F757I probably benign Het
Zbbx T C 3: 75,155,442 T3A possibly damaging Het
Zfp28 T A 7: 6,389,829 M168K probably benign Het
Zfp568 G T 7: 30,023,126 G499W probably damaging Het
Zfp7 C G 15: 76,890,931 P391R possibly damaging Het
Other mutations in Fem1b
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00811:Fem1b APN 9 62796919 missense probably damaging 1.00
IGL01306:Fem1b APN 9 62797528 missense possibly damaging 0.69
IGL02059:Fem1b APN 9 62796164 missense possibly damaging 0.57
IGL02292:Fem1b APN 9 62796695 missense probably benign 0.00
IGL03390:Fem1b APN 9 62796964 missense probably benign 0.01
physeter UTSW 9 62797634 missense probably damaging 0.99
ANU23:Fem1b UTSW 9 62797528 missense possibly damaging 0.69
R0054:Fem1b UTSW 9 62796800 missense probably damaging 1.00
R0054:Fem1b UTSW 9 62796800 missense probably damaging 1.00
R0733:Fem1b UTSW 9 62796843 missense possibly damaging 0.50
R1661:Fem1b UTSW 9 62797274 missense probably damaging 0.96
R1697:Fem1b UTSW 9 62797174 missense possibly damaging 0.56
R2228:Fem1b UTSW 9 62796738 nonsense probably null
R2326:Fem1b UTSW 9 62797003 missense probably damaging 0.98
R3123:Fem1b UTSW 9 62796554 missense probably benign 0.00
R3124:Fem1b UTSW 9 62796554 missense probably benign 0.00
R3125:Fem1b UTSW 9 62796554 missense probably benign 0.00
R4849:Fem1b UTSW 9 62797294 missense probably damaging 1.00
R5749:Fem1b UTSW 9 62797006 missense probably damaging 1.00
R6338:Fem1b UTSW 9 62797011 missense probably benign 0.08
R6727:Fem1b UTSW 9 62796733 missense possibly damaging 0.65
R7036:Fem1b UTSW 9 62797028 missense probably damaging 1.00
R7287:Fem1b UTSW 9 62796122 missense probably benign 0.00
R7538:Fem1b UTSW 9 62811167 missense probably damaging 0.98
R7877:Fem1b UTSW 9 62796562 missense probably benign 0.13
R8079:Fem1b UTSW 9 62796361 missense probably damaging 1.00
R8682:Fem1b UTSW 9 62797150 nonsense probably null
R8924:Fem1b UTSW 9 62797634 missense probably damaging 0.99
R9334:Fem1b UTSW 9 62796322 nonsense probably null
R9592:Fem1b UTSW 9 62797677 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- GCTGAGCTCAATACCACGTG -3'
(R):5'- TCTGGTCACAAAGCTCCTGC -3'

Sequencing Primer
(F):5'- CTGAGCTCAATACCACGTGAGAAAAG -3'
(R):5'- TCCTGCTGGACTGTGGC -3'
Posted On 2020-06-30