Incidental Mutation 'R8110:Proca1'
ID 630820
Institutional Source Beutler Lab
Gene Symbol Proca1
Ensembl Gene ENSMUSG00000044122
Gene Name protein interacting with cyclin A1
Synonyms
MMRRC Submission
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.064) question?
Stock # R8110 (G1)
Quality Score 225.009
Status Validated
Chromosome 11
Chromosomal Location 78193392-78205763 bp(+) (GRCm38)
Type of Mutation missense
DNA Base Change (assembly) A to G at 78204911 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change Aspartic acid to Glycine at position 123 (D123G)
Ref Sequence ENSEMBL: ENSMUSP00000103953 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000002121] [ENSMUST00000060539] [ENSMUST00000078099] [ENSMUST00000108317]
AlphaFold B0QZF7
Predicted Effect probably benign
Transcript: ENSMUST00000002121
SMART Domains Protein: ENSMUSP00000002121
Gene: ENSMUSG00000002052

DomainStartEndE-ValueType
low complexity region 2 23 N/A INTRINSIC
Pfam:SPT6_acidic 37 127 8.8e-19 PFAM
low complexity region 146 164 N/A INTRINSIC
low complexity region 170 189 N/A INTRINSIC
low complexity region 192 203 N/A INTRINSIC
low complexity region 220 250 N/A INTRINSIC
low complexity region 252 267 N/A INTRINSIC
Pfam:HTH_44 305 432 1.3e-28 PFAM
low complexity region 494 509 N/A INTRINSIC
YqgFc 779 894 4.27e-21 SMART
Pfam:HHH_7 935 1038 3.1e-55 PFAM
Pfam:HHH_3 966 1036 5.2e-10 PFAM
Pfam:DLD 1051 1159 6.8e-39 PFAM
S1 1221 1282 2.8e-3 SMART
SH2 1332 1421 4.12e-11 SMART
low complexity region 1441 1454 N/A INTRINSIC
Blast:SH2 1455 1517 9e-19 BLAST
low complexity region 1586 1599 N/A INTRINSIC
low complexity region 1639 1664 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000060539
SMART Domains Protein: ENSMUSP00000050319
Gene: ENSMUSG00000044122

DomainStartEndE-ValueType
low complexity region 42 53 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000078099
AA Change: D36G

PolyPhen 2 Score 0.991 (Sensitivity: 0.71; Specificity: 0.97)
SMART Domains Protein: ENSMUSP00000086022
Gene: ENSMUSG00000044122
AA Change: D36G

DomainStartEndE-ValueType
coiled coil region 92 121 N/A INTRINSIC
low complexity region 148 161 N/A INTRINSIC
low complexity region 198 212 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000108314
Predicted Effect probably damaging
Transcript: ENSMUST00000108317
AA Change: D123G

PolyPhen 2 Score 0.991 (Sensitivity: 0.71; Specificity: 0.97)
SMART Domains Protein: ENSMUSP00000103953
Gene: ENSMUSG00000044122
AA Change: D123G

DomainStartEndE-ValueType
Blast:PA2c 33 99 2e-12 BLAST
SCOP:d1poc__ 55 102 5e-4 SMART
coiled coil region 179 208 N/A INTRINSIC
low complexity region 235 248 N/A INTRINSIC
low complexity region 285 299 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000124772
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.7%
  • 10x: 98.6%
  • 20x: 93.1%
Validation Efficiency 99% (73/74)
Allele List at MGI
Other mutations in this stock
Total: 68 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
0610010F05Rik G T 11: 23,576,764 T696N probably benign Het
Ankrd45 T C 1: 161,151,319 probably null Het
Appl1 C A 14: 26,927,794 G592* probably null Het
Arfgef2 T A 2: 166,878,544 M1501K probably benign Het
Calcrl C T 2: 84,339,339 A333T probably damaging Het
Cd200r3 T A 16: 44,951,472 I33N probably benign Het
Ceacam15 A G 7: 16,673,409 L61P probably benign Het
Cfap69 T A 5: 5,582,515 H827L possibly damaging Het
Csmd3 T A 15: 47,644,270 E2780V probably damaging Het
Cyp2u1 G A 3: 131,293,654 T426I probably damaging Het
Eefsec A C 6: 88,376,330 I119S probably damaging Het
Fem1b T C 9: 62,796,268 N570S probably damaging Het
Fmo9 A G 1: 166,663,526 M461T probably benign Het
Fryl A G 5: 73,133,277 Y95H probably benign Het
Fsip2 T C 2: 82,958,673 I346T probably benign Het
Fto T C 8: 91,485,190 F381S probably damaging Het
Gabbr1 G C 17: 37,048,583 S150T probably benign Het
Galnt9 G T 5: 110,615,473 W448L probably damaging Het
Gcnt2 G T 13: 40,917,722 probably benign Het
Gm10800 CAAGAAAACTGAAAATCAAAGAAAACTGAAAATCA CAAGAAAACTGAAAATCA 2: 98,667,016 probably null Het
Gm17727 T C 9: 35,778,033 *84W probably null Het
Gm8882 C T 6: 132,361,568 G229D unknown Het
Gmcl1 G T 6: 86,721,426 A163E probably damaging Het
Hectd4 A G 5: 121,332,949 Y2633C possibly damaging Het
Hsd11b2 A G 8: 105,522,634 I214V probably damaging Het
Hspa12a T A 19: 58,821,013 E217V possibly damaging Het
Itih2 A G 2: 10,097,137 F845L probably damaging Het
Kcnn3 T A 3: 89,661,233 L606H probably damaging Het
Krt6b G A 15: 101,680,142 R28C probably damaging Het
Lama2 T A 10: 26,990,870 D2876V probably damaging Het
Lmbrd2 T C 15: 9,175,192 S397P probably damaging Het
Lmf2 C T 15: 89,352,358 probably null Het
Lrp2 A G 2: 69,506,453 I1325T probably benign Het
Ltbp2 A T 12: 84,803,902 C879* probably null Het
Map3k1 A G 13: 111,755,313 V1136A probably damaging Het
Mettl3 G T 14: 52,300,252 H84N probably benign Het
Mia2 A G 12: 59,109,087 probably null Het
Mlip G T 9: 77,239,579 T92K probably damaging Het
Nalcn T A 14: 123,464,701 Y466F probably benign Het
Nav2 T A 7: 49,551,950 L235* probably null Het
Nbn T C 4: 15,981,588 V560A probably benign Het
Ncln A T 10: 81,493,153 Y144N possibly damaging Het
Nfe2l2 A C 2: 75,679,421 D18E probably benign Het
Olfr102 A G 17: 37,313,713 F224L probably benign Het
Olfr1131 T C 2: 87,628,607 I48T possibly damaging Het
Olfr356 T C 2: 36,937,709 C197R possibly damaging Het
Olfr432 G A 1: 174,050,525 A51T probably benign Het
Otop3 A T 11: 115,339,395 M33L probably benign Het
Pdzd2 G A 15: 12,373,506 S2181L probably benign Het
Phf14 T C 6: 11,953,423 I387T possibly damaging Het
Prdm9 T A 17: 15,554,698 N318Y probably damaging Het
Prune2 G A 19: 17,120,719 G1196S probably benign Het
Psd3 T A 8: 68,121,056 S158C probably damaging Het
Rps18 A G 17: 33,955,136 V15A probably benign Het
Sharpin C A 15: 76,347,765 R271L possibly damaging Het
Smad5 C A 13: 56,723,888 Q99K probably damaging Het
Sox5 T C 6: 144,116,474 M151V possibly damaging Het
Sphkap A T 1: 83,278,771 F419Y possibly damaging Het
Tbx20 T A 9: 24,725,525 Y422F probably damaging Het
Tcirg1 A C 19: 3,899,099 F397V probably damaging Het
Tex36 G A 7: 133,595,283 S35F possibly damaging Het
Tsen54 G T 11: 115,814,934 A26S unknown Het
Usp50 T A 2: 126,780,330 probably null Het
Vmn2r5 A T 3: 64,491,288 F757I probably benign Het
Zbbx T C 3: 75,155,442 T3A possibly damaging Het
Zfp28 T A 7: 6,389,829 M168K probably benign Het
Zfp568 G T 7: 30,023,126 G499W probably damaging Het
Zfp7 C G 15: 76,890,931 P391R possibly damaging Het
Other mutations in Proca1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01806:Proca1 APN 11 78204911 missense probably damaging 0.99
IGL01905:Proca1 APN 11 78204890 missense probably damaging 0.98
R0396:Proca1 UTSW 11 78194905 missense probably damaging 0.96
R0398:Proca1 UTSW 11 78205268 missense probably benign 0.00
R0734:Proca1 UTSW 11 78201802 splice site probably benign
R0980:Proca1 UTSW 11 78204947 missense probably benign 0.00
R1899:Proca1 UTSW 11 78205021 missense probably damaging 0.99
R1900:Proca1 UTSW 11 78205021 missense probably damaging 0.99
R2183:Proca1 UTSW 11 78204149 missense possibly damaging 0.92
R2867:Proca1 UTSW 11 78204980 missense probably damaging 0.97
R2867:Proca1 UTSW 11 78204980 missense probably damaging 0.97
R4237:Proca1 UTSW 11 78204926 missense probably benign 0.22
R4687:Proca1 UTSW 11 78204898 missense probably damaging 0.97
R5299:Proca1 UTSW 11 78205252 missense probably damaging 0.99
R5318:Proca1 UTSW 11 78201857 missense possibly damaging 0.92
R5379:Proca1 UTSW 11 78205266 missense probably damaging 0.99
R5564:Proca1 UTSW 11 78201873 missense possibly damaging 0.81
R6592:Proca1 UTSW 11 78204953 missense probably benign 0.00
R6796:Proca1 UTSW 11 78194928 missense probably benign
R6894:Proca1 UTSW 11 78194787 unclassified probably benign
R7423:Proca1 UTSW 11 78194817 unclassified probably benign
R8952:Proca1 UTSW 11 78204947 missense probably benign 0.00
R8974:Proca1 UTSW 11 78205318 missense probably damaging 0.96
Predicted Primers PCR Primer
(F):5'- AACATCATCCATGCCCCTTG -3'
(R):5'- TTGATGACGTTGCTTTCCTGAC -3'

Sequencing Primer
(F):5'- GCTTTGAACTCATCCCAGAGG -3'
(R):5'- CACTTTTCTATGGGACTTTCAGAACG -3'
Posted On 2020-06-30