Incidental Mutation 'R8110:Mettl3'
ID 630828
Institutional Source Beutler Lab
Gene Symbol Mettl3
Ensembl Gene ENSMUSG00000022160
Gene Name methyltransferase like 3
Synonyms M6A, 2310024F18Rik, Spo8
MMRRC Submission
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock # R8110 (G1)
Quality Score 197.009
Status Validated
Chromosome 14
Chromosomal Location 52294841-52305128 bp(-) (GRCm38)
Type of Mutation missense
DNA Base Change (assembly) G to T at 52300252 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change Histidine to Asparagine at position 84 (H84N)
Ref Sequence ENSEMBL: ENSMUSP00000022767 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000022766] [ENSMUST00000022767] [ENSMUST00000122962] [ENSMUST00000145875] [ENSMUST00000147768] [ENSMUST00000173138] [ENSMUST00000173896] [ENSMUST00000174351] [ENSMUST00000174853]
AlphaFold no structure available at present
Predicted Effect probably benign
Transcript: ENSMUST00000022766
SMART Domains Protein: ENSMUSP00000022766
Gene: ENSMUSG00000016831

DomainStartEndE-ValueType
low complexity region 146 160 N/A INTRINSIC
low complexity region 207 218 N/A INTRINSIC
HMG 222 292 1.17e-18 SMART
low complexity region 307 339 N/A INTRINSIC
low complexity region 435 476 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000022767
AA Change: H84N

PolyPhen 2 Score 0.023 (Sensitivity: 0.95; Specificity: 0.81)
SMART Domains Protein: ENSMUSP00000022767
Gene: ENSMUSG00000022160
AA Change: H84N

DomainStartEndE-ValueType
low complexity region 53 67 N/A INTRINSIC
low complexity region 82 93 N/A INTRINSIC
low complexity region 191 213 N/A INTRINSIC
Pfam:MT-A70 389 550 9.9e-65 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000122962
Predicted Effect probably benign
Transcript: ENSMUST00000145875
Predicted Effect probably benign
Transcript: ENSMUST00000147768
AA Change: H84N

PolyPhen 2 Score 0.375 (Sensitivity: 0.90; Specificity: 0.89)
SMART Domains Protein: ENSMUSP00000134577
Gene: ENSMUSG00000022160
AA Change: H84N

DomainStartEndE-ValueType
low complexity region 53 67 N/A INTRINSIC
low complexity region 82 93 N/A INTRINSIC
low complexity region 191 213 N/A INTRINSIC
low complexity region 231 242 N/A INTRINSIC
Predicted Effect possibly damaging
Transcript: ENSMUST00000173138
AA Change: H84N

PolyPhen 2 Score 0.548 (Sensitivity: 0.88; Specificity: 0.91)
SMART Domains Protein: ENSMUSP00000134018
Gene: ENSMUSG00000022160
AA Change: H84N

DomainStartEndE-ValueType
low complexity region 53 67 N/A INTRINSIC
low complexity region 82 93 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000173656
SMART Domains Protein: ENSMUSP00000133759
Gene: ENSMUSG00000022160

DomainStartEndE-ValueType
Pfam:MT-A70 1 60 8.6e-17 PFAM
Predicted Effect possibly damaging
Transcript: ENSMUST00000173896
AA Change: H84N

PolyPhen 2 Score 0.548 (Sensitivity: 0.88; Specificity: 0.91)
SMART Domains Protein: ENSMUSP00000133506
Gene: ENSMUSG00000022160
AA Change: H84N

DomainStartEndE-ValueType
low complexity region 53 67 N/A INTRINSIC
low complexity region 82 93 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000174351
AA Change: H33N

PolyPhen 2 Score 0.338 (Sensitivity: 0.90; Specificity: 0.89)
SMART Domains Protein: ENSMUSP00000134732
Gene: ENSMUSG00000022160
AA Change: H33N

DomainStartEndE-ValueType
low complexity region 2 16 N/A INTRINSIC
low complexity region 31 42 N/A INTRINSIC
low complexity region 140 162 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000174360
SMART Domains Protein: ENSMUSP00000134578
Gene: ENSMUSG00000022160

DomainStartEndE-ValueType
Pfam:MT-A70 1 34 4.3e-10 PFAM
Pfam:MT-A70 30 74 1.4e-15 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000174853
SMART Domains Protein: ENSMUSP00000133864
Gene: ENSMUSG00000022160

DomainStartEndE-ValueType
low complexity region 120 142 N/A INTRINSIC
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.7%
  • 10x: 98.6%
  • 20x: 93.1%
Validation Efficiency 99% (73/74)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes the 70 kDa subunit of MT-A which is part of N6-adenosine-methyltransferase. This enzyme is involved in the posttranscriptional methylation of internal adenosine residues in eukaryotic mRNAs, forming N6-methyladenosine. [provided by RefSeq, Jul 2008]
PHENOTYPE: Mice homozygous for a knock-out allele exhibit embryonic lethality between E3.5 and E8.5 with a deficiency in adopting the epiblast egg cylinder. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 68 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
0610010F05Rik G T 11: 23,576,764 T696N probably benign Het
Ankrd45 T C 1: 161,151,319 probably null Het
Appl1 C A 14: 26,927,794 G592* probably null Het
Arfgef2 T A 2: 166,878,544 M1501K probably benign Het
Calcrl C T 2: 84,339,339 A333T probably damaging Het
Cd200r3 T A 16: 44,951,472 I33N probably benign Het
Ceacam15 A G 7: 16,673,409 L61P probably benign Het
Cfap69 T A 5: 5,582,515 H827L possibly damaging Het
Csmd3 T A 15: 47,644,270 E2780V probably damaging Het
Cyp2u1 G A 3: 131,293,654 T426I probably damaging Het
Eefsec A C 6: 88,376,330 I119S probably damaging Het
Fem1b T C 9: 62,796,268 N570S probably damaging Het
Fmo9 A G 1: 166,663,526 M461T probably benign Het
Fryl A G 5: 73,133,277 Y95H probably benign Het
Fsip2 T C 2: 82,958,673 I346T probably benign Het
Fto T C 8: 91,485,190 F381S probably damaging Het
Gabbr1 G C 17: 37,048,583 S150T probably benign Het
Galnt9 G T 5: 110,615,473 W448L probably damaging Het
Gcnt2 G T 13: 40,917,722 probably benign Het
Gm10800 CAAGAAAACTGAAAATCAAAGAAAACTGAAAATCA CAAGAAAACTGAAAATCA 2: 98,667,016 probably null Het
Gm17727 T C 9: 35,778,033 *84W probably null Het
Gm8882 C T 6: 132,361,568 G229D unknown Het
Gmcl1 G T 6: 86,721,426 A163E probably damaging Het
Hectd4 A G 5: 121,332,949 Y2633C possibly damaging Het
Hsd11b2 A G 8: 105,522,634 I214V probably damaging Het
Hspa12a T A 19: 58,821,013 E217V possibly damaging Het
Itih2 A G 2: 10,097,137 F845L probably damaging Het
Kcnn3 T A 3: 89,661,233 L606H probably damaging Het
Krt6b G A 15: 101,680,142 R28C probably damaging Het
Lama2 T A 10: 26,990,870 D2876V probably damaging Het
Lmbrd2 T C 15: 9,175,192 S397P probably damaging Het
Lmf2 C T 15: 89,352,358 probably null Het
Lrp2 A G 2: 69,506,453 I1325T probably benign Het
Ltbp2 A T 12: 84,803,902 C879* probably null Het
Map3k1 A G 13: 111,755,313 V1136A probably damaging Het
Mia2 A G 12: 59,109,087 probably null Het
Mlip G T 9: 77,239,579 T92K probably damaging Het
Nalcn T A 14: 123,464,701 Y466F probably benign Het
Nav2 T A 7: 49,551,950 L235* probably null Het
Nbn T C 4: 15,981,588 V560A probably benign Het
Ncln A T 10: 81,493,153 Y144N possibly damaging Het
Nfe2l2 A C 2: 75,679,421 D18E probably benign Het
Olfr102 A G 17: 37,313,713 F224L probably benign Het
Olfr1131 T C 2: 87,628,607 I48T possibly damaging Het
Olfr356 T C 2: 36,937,709 C197R possibly damaging Het
Olfr432 G A 1: 174,050,525 A51T probably benign Het
Otop3 A T 11: 115,339,395 M33L probably benign Het
Pdzd2 G A 15: 12,373,506 S2181L probably benign Het
Phf14 T C 6: 11,953,423 I387T possibly damaging Het
Prdm9 T A 17: 15,554,698 N318Y probably damaging Het
Proca1 A G 11: 78,204,911 D123G probably damaging Het
Prune2 G A 19: 17,120,719 G1196S probably benign Het
Psd3 T A 8: 68,121,056 S158C probably damaging Het
Rps18 A G 17: 33,955,136 V15A probably benign Het
Sharpin C A 15: 76,347,765 R271L possibly damaging Het
Smad5 C A 13: 56,723,888 Q99K probably damaging Het
Sox5 T C 6: 144,116,474 M151V possibly damaging Het
Sphkap A T 1: 83,278,771 F419Y possibly damaging Het
Tbx20 T A 9: 24,725,525 Y422F probably damaging Het
Tcirg1 A C 19: 3,899,099 F397V probably damaging Het
Tex36 G A 7: 133,595,283 S35F possibly damaging Het
Tsen54 G T 11: 115,814,934 A26S unknown Het
Usp50 T A 2: 126,780,330 probably null Het
Vmn2r5 A T 3: 64,491,288 F757I probably benign Het
Zbbx T C 3: 75,155,442 T3A possibly damaging Het
Zfp28 T A 7: 6,389,829 M168K probably benign Het
Zfp568 G T 7: 30,023,126 G499W probably damaging Het
Zfp7 C G 15: 76,890,931 P391R possibly damaging Het
Other mutations in Mettl3
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00401:Mettl3 APN 14 52296967 unclassified probably benign
IGL00508:Mettl3 APN 14 52294979 unclassified probably benign
R0417:Mettl3 UTSW 14 52296698 missense probably damaging 1.00
R1533:Mettl3 UTSW 14 52296928 missense probably benign 0.01
R2113:Mettl3 UTSW 14 52294984 makesense probably null
R3785:Mettl3 UTSW 14 52299906 missense probably benign 0.15
R3786:Mettl3 UTSW 14 52299906 missense probably benign 0.15
R4651:Mettl3 UTSW 14 52295092 missense probably damaging 1.00
R4652:Mettl3 UTSW 14 52295092 missense probably damaging 1.00
R4938:Mettl3 UTSW 14 52299727 missense probably damaging 1.00
R5462:Mettl3 UTSW 14 52299879 missense probably damaging 0.96
R6046:Mettl3 UTSW 14 52298786 missense possibly damaging 0.91
R6151:Mettl3 UTSW 14 52295020 missense probably damaging 1.00
R6169:Mettl3 UTSW 14 52298757 missense possibly damaging 0.88
R6225:Mettl3 UTSW 14 52296758 splice site probably null
R6282:Mettl3 UTSW 14 52297971 missense probably benign 0.01
R8038:Mettl3 UTSW 14 52299964 missense possibly damaging 0.80
R9332:Mettl3 UTSW 14 52296668 missense probably damaging 1.00
RF001:Mettl3 UTSW 14 52300299 missense probably benign
X0025:Mettl3 UTSW 14 52298088 splice site probably null
Predicted Primers PCR Primer
(F):5'- TCTTGAGTGGCAGGTGCATC -3'
(R):5'- CTAGCGATGCTGGACAGTTG -3'

Sequencing Primer
(F):5'- GCAGGTGCATCTGGCTAAAG -3'
(R):5'- ATGCTGGACAGTTGAACCC -3'
Posted On 2020-06-30