Mutagenetix > Incidental Mutations

Incidental Mutation 'R8137:Olfr1208'

632287

Institutional Source

Beutler Lab

Gene Symbol

Olfr1208

Ensembl Gene

ENSMUSG00000075114

Gene Name

olfactory receptor 1208

Synonyms

MOR225-4, GA_x6K02T2Q125-50372411-50371485

MMRRC Submission

Accession Numbers

Is this an essential gene?

Probably non essential (E-score: 0.060) question?

Stock #

R8137 (G1)

Quality Score

225.009

Status

Validated

Chromosome

Chromosomal Location

88895575-88902311 bp(-) (GRCm38)

Type of Mutation

makesense

DNA Base Change (assembly)

T to C at 88896669 bp

Zygosity

Heterozygous

Amino Acid Change

Stop codon to Tryptophan at position 309 (*309W)

Ref Sequence

ENSEMBL: ENSMUSP00000149280 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000099810] [ENSMUST00000214121] [ENSMUST00000214297]

Predicted Effect

probably null
Transcript: ENSMUST00000099810
AA Change: *309W

SMART Domains

Protein: ENSMUSP00000097398
Gene: ENSMUSG00000075114
AA Change: *309W

Domain	Start	End	E-Value	Type
Pfam:7tm_4	28	302	1.9e-48	PFAM
Pfam:7tm_1	38	284	2.6e-17	PFAM

Predicted Effect

probably null
Transcript: ENSMUST00000214121
AA Change: *309W

Predicted Effect

probably null
Transcript: ENSMUST00000214297
AA Change: *309W

Coding Region Coverage

1x: 99.8%
3x: 99.6%
10x: 98.8%
20x: 96.4%

Validation Efficiency

100% (56/56)

MGI Phenotype

FUNCTION: Olfactory receptors interact with odorant molecules in the nose, to initiate a neuronal response that triggers the perception of a smell. The olfactory receptor proteins are members of a large family of G-protein-coupled receptors (GPCR) arising from single coding-exon genes. Olfactory receptors share a 7-transmembrane domain structure with many neurotransmitter and hormone receptors and are responsible for the recognition and G protein-mediated transduction of odorant signals. The olfactory receptor gene family is the largest in the genome. The nomenclature assigned to the olfactory receptor genes and proteins for this organism is independent of other organisms. [provided by RefSeq, Jul 2008]

Allele List at MGI

Other mutations in this stock

Total: 54 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
Ankfn1	T	G	11: 89,453,177	Q326H	probably benign	Het
Carf	G	A	1: 60,147,965	V576I	probably benign	Het
Ccnl1	C	T	3: 65,957,870	D87N	possibly damaging	Het
Cgref1	T	A	5: 30,934,405	D111V	possibly damaging	Het
Cnot4	G	A	6: 35,046,287	P567S	unknown	Het
Cyp7b1	A	T	3: 18,097,601	D149E	probably benign	Het
Dcc	A	T	18: 71,378,712	D877E	probably benign	Het
Dhx8	T	A	11: 101,763,982	I1032N	probably damaging	Het
Dnah7b	A	G	1: 46,233,753	Y2347C	probably damaging	Het
Dtx3	A	G	10: 127,193,172	S63P	possibly damaging	Het
Dyrk2	C	T	10: 118,859,884	E490K	probably benign	Het
Fcgbp	A	C	7: 28,105,071	Y1868S	probably damaging	Het
Foxa2	T	C	2: 148,043,848	H355R	probably benign	Het
Fpr-rs7	A	G	17: 20,113,793	V145A	possibly damaging	Het
Gm13089	A	G	4: 143,699,265	F36S	probably damaging	Het
Gm14137	A	T	2: 119,175,356	E132V	probably benign	Het
Gpn2	T	C	4: 133,588,562	S211P	possibly damaging	Het
Greb1l	A	T	18: 10,474,357	Q224L	possibly damaging	Het
Gspt1	A	G	16: 11,240,668	V144A	probably benign	Het
Ifi204	A	G	1: 173,761,622	I81T	possibly damaging	Het
Il27ra	T	A	8: 84,041,091		probably null	Het
Kif21a	T	C	15: 90,968,442	T862A	probably benign	Het
Klf2	T	C	8: 72,320,244		probably null	Het
Kmt2e	A	G	5: 23,501,954	Y1505C	probably damaging	Het
Mcm9	T	C	10: 53,622,980	T216A		Het
Muc16	T	C	9: 18,645,676	E3107G	unknown	Het
Ncor2	C	T	5: 125,037,893	V169I		Het
Oas3	T	C	5: 120,777,500	Q42R	probably benign	Het
Olfr167	A	G	16: 19,515,096	V180A	possibly damaging	Het
Pde10a	A	G	17: 8,974,815	Y693C	possibly damaging	Het
Pde11a	T	C	2: 76,211,039	E429G	possibly damaging	Het
Pygo1	A	G	9: 72,944,858	H109R	probably damaging	Het
Rbsn	A	T	6: 92,190,022	V547D	probably benign	Het
Ros1	A	G	10: 52,125,837	I1084T	possibly damaging	Het
Sis	T	C	3: 72,889,045	D1801G	probably benign	Het
Slco4c1	C	T	1: 96,821,245	G649E	probably damaging	Het
Sptbn2	A	T	19: 4,737,403	I914F	possibly damaging	Het
Srebf2	C	T	15: 82,178,765	R468C	probably damaging	Het
Strc	C	T	2: 121,366,738	G1503R	probably damaging	Het
Sv2c	T	A	13: 96,088,663	Y46F	probably damaging	Het
Tctn3	A	T	19: 40,605,341	W462R	probably damaging	Het
Tex43	A	G	18: 56,594,581	D117G	probably damaging	Het
Tjp3	T	C	10: 81,273,691	D857G	probably benign	Het
Tor1aip2	C	T	1: 156,063,668	T242I	possibly damaging	Het
Ttn	T	A	2: 76,969,929	I312F	unknown	Het
Vezt	T	C	10: 93,939,292	N94D		Het
Vmn2r105	T	C	17: 20,234,704	N57D	probably benign	Het
Wdr59	T	C	8: 111,485,379	D353G		Het
Ykt6	T	C	11: 5,959,368	V59A	probably damaging	Het
Ypel3	T	G	7: 126,778,097	V54G	possibly damaging	Het
Zfp386	T	A	12: 116,059,648	C329S	possibly damaging	Het
Zfp451	A	T	1: 33,782,075	L232H	possibly damaging	Het
Zfp648	A	G	1: 154,205,364	H423R	probably damaging	Het
Zfp729b	T	C	13: 67,592,742	Y468C	probably damaging	Het

Other mutations in Olfr1208

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL01340:Olfr1208	APN	2	88896977	missense	probably damaging	1.00
IGL02132:Olfr1208	APN	2	88897159	missense	probably benign
IGL02374:Olfr1208	APN	2	88897459	missense	probably damaging	1.00
R1378:Olfr1208	UTSW	2	88897026	missense	probably benign	0.01
R1570:Olfr1208	UTSW	2	88896946	missense	probably damaging	1.00
R2056:Olfr1208	UTSW	2	88896761	missense	probably damaging	1.00
R2092:Olfr1208	UTSW	2	88897267	missense	probably damaging	0.99
R2185:Olfr1208	UTSW	2	88896703	missense	probably damaging	0.99
R5223:Olfr1208	UTSW	2	88897334	missense	probably benign	0.03
R5479:Olfr1208	UTSW	2	88896691	missense	probably benign	0.13
R6463:Olfr1208	UTSW	2	88897118	missense	probably benign	0.00
R6859:Olfr1208	UTSW	2	88896934	missense	probably benign
R7347:Olfr1208	UTSW	2	88897271	missense	possibly damaging	0.51
R7352:Olfr1208	UTSW	2	88896718	missense	probably damaging	1.00
R7544:Olfr1208	UTSW	2	88897361	missense	probably damaging	1.00
R7713:Olfr1208	UTSW	2	88897778	start gained	probably benign
R7842:Olfr1208	UTSW	2	88896961	missense	possibly damaging	0.89
R7869:Olfr1208	UTSW	2	88897064	missense	probably benign	0.00
R8168:Olfr1208	UTSW	2	88896776	missense	probably benign	0.09
Z1176:Olfr1208	UTSW	2	88897061	missense	probably damaging	1.00
Z1177:Olfr1208	UTSW	2	88896800	nonsense	probably null

Predicted Primers

PCR Primer
(F):5'- AGCCATTATATCTGGGATGATGAAG -3'
(R):5'- ACACATCACCGTTGTATTCATGTTC -3'

Sequencing Primer
(F):5'- GGGATGATGAAGGAGGAAATAATTTC -3'
(R):5'- ACCGTTGTATTCATGTTCTTCTTG -3'

Posted On

2020-06-30