Incidental Mutation 'R7587:Asah1'
ID587213
Institutional Source Beutler Lab
Gene Symbol Asah1
Ensembl Gene ENSMUSG00000031591
Gene NameN-acylsphingosine amidohydrolase 1
Synonymsacid ceramidase, 2310081N20Rik
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R7587 (G1)
Quality Score225.009
Status Not validated
Chromosome8
Chromosomal Location41340197-41374773 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to T at 41374541 bp
ZygosityHeterozygous
Amino Acid Change Valine to Aspartic acid at position 15 (V15D)
Ref Sequence ENSEMBL: ENSMUSP00000034000 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000034000] [ENSMUST00000110417] [ENSMUST00000143057]
Predicted Effect probably benign
Transcript: ENSMUST00000034000
AA Change: V15D

PolyPhen 2 Score 0.430 (Sensitivity: 0.89; Specificity: 0.90)
SMART Domains Protein: ENSMUSP00000034000
Gene: ENSMUSG00000031591
AA Change: V15D

DomainStartEndE-ValueType
signal peptide 1 20 N/A INTRINSIC
Pfam:NAAA-beta 44 138 4.2e-35 PFAM
Pfam:CBAH 142 389 1e-58 PFAM
Predicted Effect
SMART Domains Protein: ENSMUSP00000106047
Gene: ENSMUSG00000031591
AA Change: V15D

DomainStartEndE-ValueType
Pfam:NAAA-beta 24 118 8.8e-39 PFAM
Pfam:CBAH 122 216 7.9e-24 PFAM
Predicted Effect
SMART Domains Protein: ENSMUSP00000117362
Gene: ENSMUSG00000031591
AA Change: S53R

DomainStartEndE-ValueType
signal peptide 1 26 N/A INTRINSIC
Pfam:NAAA-beta 68 120 6.4e-18 PFAM
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 100.0%
  • 10x: 99.8%
  • 20x: 99.5%
Validation Efficiency
MGI Phenotype FUNCTION: This gene encodes acid ceramidase, an enzyme that plays a central role in ceramide metabolism. The encoded protein undergoes proteolytic processing to generate a heterodimeric enzyme comprised of alpha and beta subunits that catalyzes the hydrolysis of sphingolipid ceramide into sphingosine and free fatty acid. The homozygous disruption of this gene leads to embryonic lethality in mice whereas the heterozygous animals exhibit a progressive lipid storage disease phenotype. [provided by RefSeq, Oct 2015]
PHENOTYPE: Nullizygous mutation of this gene causes embryonic lethality. Homozygotes for the P361R mutation die prematurely with growth defects, low acid ceramidase activity, high ceramide levels, histiocyte infiltrates into various organs, Farber bodies, short femur growth plates and altered ovary morphology. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 59 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Agl T C 3: 116,792,087 T131A probably damaging Het
Asic1 A C 15: 99,695,590 Q276P probably damaging Het
Atl2 A T 17: 79,865,067 V158E probably benign Het
Atrn T A 2: 130,980,114 I909N probably damaging Het
BC034090 A G 1: 155,217,486 V742A probably damaging Het
Capzb T A 4: 139,262,023 D85E possibly damaging Het
Cdh20 T C 1: 104,941,279 F165S probably damaging Het
Cfap44 A G 16: 44,404,106 E59G probably benign Het
Clpsl2 G A 17: 28,549,541 V10I probably benign Het
D630003M21Rik T C 2: 158,196,388 Y1046C probably benign Het
D630003M21Rik T A 2: 158,201,056 S855C probably damaging Het
D6Wsu163e A G 6: 126,955,896 I361V probably benign Het
Dchs2 A G 3: 83,304,515 I1874V probably benign Het
Dennd2a T G 6: 39,483,135 K679Q probably damaging Het
Dio2 A G 12: 90,729,560 V218A probably benign Het
Fam208b T C 13: 3,568,849 K2251E possibly damaging Het
Gm3286 A G 5: 95,521,411 T100A probably damaging Het
Gpr107 A T 2: 31,168,826 K109N probably benign Het
Gpr108 C T 17: 57,236,732 R448Q probably damaging Het
Gucy2c A G 6: 136,704,290 V932A probably damaging Het
Kcnj8 T C 6: 142,566,339 T181A probably damaging Het
Lipc A G 9: 70,818,924 Y168H probably damaging Het
Lipi C T 16: 75,550,215 V439M probably benign Het
Lrp1b T G 2: 40,730,717 D3583A Het
Ltbr T C 6: 125,312,352 T165A probably benign Het
Mroh3 A G 1: 136,190,998 I527T probably benign Het
Mylk A G 16: 34,922,517 E1133G probably benign Het
Nat3 T C 8: 67,547,574 I35T probably damaging Het
Nedd1 G A 10: 92,698,730 T306M probably benign Het
Nexn T C 3: 152,247,178 R316G probably benign Het
Nox4 A G 7: 87,317,302 H207R probably damaging Het
Nsun6 T C 2: 15,039,825 Q110R probably benign Het
Olfr22-ps1 C T 11: 73,955,184 Q165* probably null Het
Olfr668 C T 7: 104,925,056 R236H probably benign Het
Olfr851 T A 9: 19,497,522 V258E probably damaging Het
Pappa2 T C 1: 158,851,131 D905G probably damaging Het
Pepd T C 7: 34,969,540 L195S probably damaging Het
Pms1 A G 1: 53,207,316 S355P probably benign Het
Pop1 A T 15: 34,502,413 K82M probably damaging Het
Ppp1r9b T A 11: 95,001,940 D655E possibly damaging Het
Ppt2 A G 17: 34,626,803 probably null Het
Prss35 T A 9: 86,755,374 C66S probably damaging Het
Rfc3 A T 5: 151,651,151 M1K probably null Het
Rffl T C 11: 82,810,148 D284G probably damaging Het
Robo3 T C 9: 37,429,646 D110G probably damaging Het
Rtel1 G A 2: 181,322,315 V36M probably damaging Het
Slc1a7 T A 4: 108,010,486 I457K possibly damaging Het
Smco1 A G 16: 32,273,723 M71V probably benign Het
Snrnp200 G A 2: 127,227,902 S989N probably damaging Het
Spef2 T A 15: 9,713,219 I356F probably damaging Het
Stk24 C T 14: 121,302,287 A166T probably damaging Het
Tada2b T C 5: 36,476,767 I156V probably benign Het
Tbce C T 13: 14,019,742 V111M probably damaging Het
Tlnrd1 A G 7: 83,882,947 L92P probably damaging Het
Tnr T A 1: 159,886,208 D735E probably benign Het
Tram1 T C 1: 13,579,547 H110R probably damaging Het
Ttll3 CAAAGTAA CAAAGTAAAGTAA 6: 113,399,157 probably null Het
Unc5b C T 10: 60,783,120 C81Y probably damaging Het
Vps13a G A 19: 16,703,789 T1041M probably benign Het
Other mutations in Asah1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01824:Asah1 APN 8 41349543 unclassified probably benign
IGL02512:Asah1 APN 8 41360307 intron probably benign
IGL02523:Asah1 APN 8 41351947 missense probably benign
IGL03115:Asah1 APN 8 41360299 missense possibly damaging 0.94
IGL03357:Asah1 APN 8 41346196 splice site probably benign
PIT4366001:Asah1 UTSW 8 41343746 missense possibly damaging 0.94
R0593:Asah1 UTSW 8 41349582 missense probably benign 0.02
R1451:Asah1 UTSW 8 41354012 critical splice donor site probably null
R1977:Asah1 UTSW 8 41343517 critical splice donor site probably null
R2200:Asah1 UTSW 8 41343728 critical splice donor site probably null
R3429:Asah1 UTSW 8 41351888 unclassified probably benign
R4002:Asah1 UTSW 8 41348139 splice site probably benign
R4078:Asah1 UTSW 8 41354082 missense probably damaging 0.99
R4470:Asah1 UTSW 8 41343724 splice site probably null
R4471:Asah1 UTSW 8 41343724 splice site probably null
R4968:Asah1 UTSW 8 41354030 missense possibly damaging 0.89
R4970:Asah1 UTSW 8 41360277 nonsense probably null
R5643:Asah1 UTSW 8 41360295 missense possibly damaging 0.94
R5644:Asah1 UTSW 8 41360295 missense possibly damaging 0.94
R6128:Asah1 UTSW 8 41354055 missense probably damaging 1.00
R6419:Asah1 UTSW 8 41343766 missense probably damaging 1.00
R7059:Asah1 UTSW 8 41347069 missense probably damaging 0.96
R7442:Asah1 UTSW 8 41343565 missense possibly damaging 0.60
R7663:Asah1 UTSW 8 41341627 missense probably damaging 0.98
Predicted Primers PCR Primer
(F):5'- ACATTTGCACCCATACTCCG -3'
(R):5'- CTAAGGCTGGACGAAACCACTG -3'

Sequencing Primer
(F):5'- ATACTCCGCGGGACCGAAC -3'
(R):5'- ACTCCGCTCTAGGGACTC -3'
Posted On2019-10-24