Incidental Mutation 'R9478:Oit3'
ID 715938
Institutional Source Beutler Lab
Gene Symbol Oit3
Ensembl Gene ENSMUSG00000009654
Gene Name oncoprotein induced transcript 3
Synonyms EF-9
MMRRC Submission
Accession Numbers
Essential gene? Possibly non essential (E-score: 0.252) question?
Stock # R9478 (G1)
Quality Score 225.009
Status Not validated
Chromosome 10
Chromosomal Location 59422958-59441778 bp(-) (GRCm38)
Type of Mutation missense
DNA Base Change (assembly) C to A at 59438642 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change Cysteine to Phenylalanine at position 112 (C112F)
Ref Sequence ENSEMBL: ENSMUSP00000009798 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000009798]
AlphaFold Q8R4V5
Predicted Effect probably damaging
Transcript: ENSMUST00000009798
AA Change: C112F

PolyPhen 2 Score 0.994 (Sensitivity: 0.69; Specificity: 0.97)
SMART Domains Protein: ENSMUSP00000009798
Gene: ENSMUSG00000009654
AA Change: C112F

DomainStartEndE-ValueType
signal peptide 1 19 N/A INTRINSIC
Blast:ZP 50 144 9e-24 BLAST
EGF 150 181 2.16e1 SMART
EGF 185 222 2.94e-3 SMART
EGF 226 263 2.35e-2 SMART
ZP 267 516 2.74e-30 SMART
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 100.0%
  • 10x: 99.9%
  • 20x: 99.6%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene was identified due to its downregulation in hepatocarcinomas. The encoded protein may be involved in liver development and function. [provided by RefSeq, Sep 2016]
PHENOTYPE: Mice homozygous for a knock-out allele exhibit decreased bloord uric acid, increased urine uric acid and polyuria. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 60 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2210408I21Rik A T 13: 77,303,454 I886F possibly damaging Het
3100002H09Rik A G 4: 124,610,358 S134P unknown Het
Abcf2 A G 5: 24,565,942 L604P possibly damaging Het
Arih2 C G 9: 108,611,739 R260P probably damaging Het
Atg14 G T 14: 47,545,681 H373Q probably damaging Het
Atmin C T 8: 116,954,798 H179Y probably damaging Het
Catsperg1 G T 7: 29,198,352 P197T possibly damaging Het
Ccdc189 T C 7: 127,584,915 probably null Het
Ccdc7b C T 8: 129,110,992 Q155* probably null Het
Cep85l T G 10: 53,348,779 E238A possibly damaging Het
Cntln G A 4: 84,979,393 V406I probably benign Het
Csf2rb2 C A 15: 78,284,765 G730V probably benign Het
Cyp3a59 T A 5: 146,098,187 L225Q probably damaging Het
Dock1 T A 7: 134,766,233 F511I probably damaging Het
Dsg1b A T 18: 20,397,951 Y453F Het
Dync1h1 T C 12: 110,658,703 F3829L probably benign Het
Epha8 G T 4: 136,938,586 L420M probably damaging Het
Esco2 C A 14: 65,831,208 G218* probably null Het
Gale C T 4: 135,965,263 probably benign Het
Grid1 G A 14: 35,321,707 D340N probably damaging Het
Hgf A G 5: 16,561,031 D55G possibly damaging Het
Il17ra A G 6: 120,474,375 D170G possibly damaging Het
Inha A G 1: 75,509,918 S286G probably benign Het
Kdelc2 T C 9: 53,391,936 F232L probably damaging Het
Kif1b C T 4: 149,261,159 probably null Het
Klhl24 T G 16: 20,123,013 S570R possibly damaging Het
Krt83 G A 15: 101,487,568 R308W probably benign Het
Lama2 T A 10: 27,015,482 E2545V probably damaging Het
Lztfl1 T C 9: 123,708,102 K165E possibly damaging Het
Mab21l3 A T 3: 101,818,671 D336E probably damaging Het
Matn2 T C 15: 34,345,096 I83T probably damaging Het
Mfsd9 T C 1: 40,773,781 D458G probably benign Het
Ncbp3 A G 11: 73,077,942 D513G probably damaging Het
Neb T A 2: 52,188,776 K5818N probably benign Het
Nol4 G A 18: 22,920,877 P120S probably damaging Het
Olfr1270 C A 2: 90,149,251 A252S possibly damaging Het
Olfr472 G A 7: 107,903,031 V105M probably damaging Het
Olfr743 A T 14: 50,533,594 T61S probably benign Het
Olfr782 T A 10: 129,351,091 M176K possibly damaging Het
Pank4 G A 4: 154,980,108 R708Q probably benign Het
Plch1 T A 3: 63,699,404 L1026F probably benign Het
Ptpn3 A T 4: 57,197,573 I772N probably damaging Het
Purb A G 11: 6,475,424 F155L probably damaging Het
Rcor2 C T 19: 7,271,429 R256W probably damaging Het
Rp1 A G 1: 4,347,322 L1189P probably benign Het
Scn1a T C 2: 66,326,149 E472G probably benign Het
Sema3e T C 5: 14,236,372 Y536H probably damaging Het
Serpina3n A T 12: 104,412,413 I331F possibly damaging Het
Sertad3 T C 7: 27,476,254 S38P probably damaging Het
Sfrp4 G T 13: 19,623,440 R3L unknown Het
Slc35a5 T C 16: 45,144,063 E269G probably damaging Het
Snrnp200 G A 2: 127,235,073 probably null Het
Sumo1 A G 1: 59,655,456 probably null Het
Syne2 A G 12: 76,107,613 K2020E probably damaging Het
Tcp10a A T 17: 7,334,341 T247S probably benign Het
Tgds T C 14: 118,115,132 D290G possibly damaging Het
Trav7d-3 A T 14: 52,744,597 I32F possibly damaging Het
Vps41 A G 13: 18,862,743 N788D Het
Zfp521 G A 18: 13,817,315 T1194I probably damaging Het
Zmynd8 C A 2: 165,807,649 K841N probably damaging Het
Other mutations in Oit3
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01457:Oit3 APN 10 59425484 unclassified probably benign
IGL01665:Oit3 APN 10 59438909 missense probably damaging 1.00
IGL01839:Oit3 APN 10 59429496 missense probably damaging 0.98
IGL02028:Oit3 APN 10 59438655 missense probably damaging 0.98
PIT4585001:Oit3 UTSW 10 59431013 missense possibly damaging 0.54
R0567:Oit3 UTSW 10 59435978 missense probably damaging 0.99
R0781:Oit3 UTSW 10 59428194 missense probably damaging 1.00
R1110:Oit3 UTSW 10 59428194 missense probably damaging 1.00
R1563:Oit3 UTSW 10 59428074 missense probably damaging 1.00
R1623:Oit3 UTSW 10 59428239 missense probably damaging 0.99
R1693:Oit3 UTSW 10 59425417 missense probably damaging 1.00
R1754:Oit3 UTSW 10 59427940 splice site probably null
R1853:Oit3 UTSW 10 59441622 critical splice donor site probably null
R2070:Oit3 UTSW 10 59431013 missense probably benign 0.03
R2211:Oit3 UTSW 10 59428070 missense probably damaging 1.00
R2516:Oit3 UTSW 10 59428345 missense probably damaging 1.00
R2516:Oit3 UTSW 10 59441685 start gained probably benign
R3103:Oit3 UTSW 10 59438891 missense probably damaging 0.98
R4414:Oit3 UTSW 10 59428103 missense probably damaging 1.00
R4415:Oit3 UTSW 10 59428103 missense probably damaging 1.00
R4416:Oit3 UTSW 10 59428103 missense probably damaging 1.00
R4417:Oit3 UTSW 10 59428103 missense probably damaging 1.00
R4584:Oit3 UTSW 10 59425462 missense probably damaging 1.00
R4734:Oit3 UTSW 10 59424082 missense probably damaging 0.99
R4748:Oit3 UTSW 10 59424082 missense probably damaging 0.99
R4749:Oit3 UTSW 10 59424082 missense probably damaging 0.99
R5070:Oit3 UTSW 10 59424027 missense probably damaging 1.00
R5521:Oit3 UTSW 10 59435914 missense probably benign
R6326:Oit3 UTSW 10 59428239 missense probably damaging 1.00
R6490:Oit3 UTSW 10 59438552 missense possibly damaging 0.92
R6526:Oit3 UTSW 10 59429640 missense probably damaging 1.00
R6766:Oit3 UTSW 10 59438712 missense probably damaging 0.99
R6921:Oit3 UTSW 10 59435945 missense probably damaging 0.99
R7129:Oit3 UTSW 10 59428344 missense probably damaging 0.99
R7440:Oit3 UTSW 10 59429570 missense probably damaging 0.99
R7495:Oit3 UTSW 10 59423943 missense possibly damaging 0.74
R7512:Oit3 UTSW 10 59438894 missense probably damaging 1.00
R7866:Oit3 UTSW 10 59424030 missense probably benign 0.03
R8312:Oit3 UTSW 10 59438810 missense probably benign 0.01
R8321:Oit3 UTSW 10 59428160 missense probably benign 0.00
R8919:Oit3 UTSW 10 59441646 missense unknown
R9131:Oit3 UTSW 10 59435929 missense probably benign 0.01
R9457:Oit3 UTSW 10 59441683 start codon destroyed unknown
R9502:Oit3 UTSW 10 59428351 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- CAATAACTGGCTTTCATACGGTGC -3'
(R):5'- TTCGACGAGTCCCAGAATCAAC -3'

Sequencing Primer
(F):5'- GGCTTTCATACGGTGCCTTTC -3'
(R):5'- TCTTTGCGACAACCATATGAACGG -3'
Posted On 2022-06-15