Incidental Mutation 'BB012:Cdh20'
ID 642680
Institutional Source Beutler Lab
Gene Symbol Cdh20
Ensembl Gene ENSMUSG00000050840
Gene Name cadherin 20
Synonyms Cdh7
Accession Numbers
Essential gene? Possibly non essential (E-score: 0.301) question?
Stock # BB012
Quality Score 225.009
Status Not validated
Chromosome 1
Chromosomal Location 104696254-104923206 bp(+) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) A to T at 104912473 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Isoleucine to Phenylalanine at position 576 (I576F)
Ref Sequence ENSEMBL: ENSMUSP00000052078 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000062528]
AlphaFold Q9Z0M3
Predicted Effect probably damaging
Transcript: ENSMUST00000062528
AA Change: I576F

PolyPhen 2 Score 0.993 (Sensitivity: 0.70; Specificity: 0.97)
SMART Domains Protein: ENSMUSP00000052078
Gene: ENSMUSG00000050840
AA Change: I576F

DomainStartEndE-ValueType
transmembrane domain 12 34 N/A INTRINSIC
CA 82 163 1.01e-15 SMART
CA 187 272 1.35e-30 SMART
CA 296 388 1.98e-14 SMART
CA 411 492 1.61e-23 SMART
CA 515 602 3.9e-13 SMART
transmembrane domain 620 642 N/A INTRINSIC
Pfam:Cadherin_C 645 793 2.6e-49 PFAM
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.7%
  • 20x: 99.0%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene is a type II classical cadherin from the cadherin superfamily and one of three cadherin 7-like genes located in a cluster on chromosome 18. The encoded membrane protein is a calcium dependent cell-cell adhesion glycoprotein comprised of five extracellular cadherin repeats, a transmembrane region and a highly conserved cytoplasmic tail. Type II (atypical) cadherins are defined based on their lack of a HAV cell adhesion recognition sequence specific to type I cadherins. Since disturbance of intracellular adhesion is a prerequisite for invasion and metastasis of tumor cells, cadherins are considered prime candidates for tumor suppressor genes. [provided by RefSeq, Jul 2008]
Allele List at MGI

All alleles(1) : Targeted, other(1)

Other mutations in this stock
Total: 58 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4930433I11Rik C T 7: 40,643,506 (GRCm39) Q392* probably null Het
4933427D14Rik A C 11: 72,071,327 (GRCm39) L473V probably benign Het
A930002H24Rik A T 17: 64,170,392 (GRCm39) V132E unknown Het
Abcc2 A G 19: 43,795,551 (GRCm39) I436V probably benign Het
Ahr G A 12: 35,565,067 (GRCm39) Q103* probably null Het
Asb15 T A 6: 24,562,723 (GRCm39) H228Q probably benign Het
Asphd1 T A 7: 126,547,628 (GRCm39) Y225F probably damaging Het
Atp2c1 A G 9: 105,319,969 (GRCm39) M468T possibly damaging Het
Brca1 A G 11: 101,398,972 (GRCm39) I1540T probably benign Het
Ccn5 G C 2: 163,670,961 (GRCm39) R156T possibly damaging Het
Chst11 T A 10: 83,026,788 (GRCm39) S72T probably damaging Het
Cldn17 T G 16: 88,303,533 (GRCm39) K65N probably damaging Het
Cldn22 T C 8: 48,278,222 (GRCm39) I220T probably benign Het
Coasy T G 11: 100,974,522 (GRCm39) D229E probably benign Het
Colec10 T C 15: 54,325,767 (GRCm39) V199A probably damaging Het
Cpn2 G T 16: 30,079,619 (GRCm39) D27E probably damaging Het
F5 T A 1: 164,003,935 (GRCm39) probably null Het
Fat3 C T 9: 15,942,656 (GRCm39) V1239I possibly damaging Het
Fbxl16 A G 17: 26,035,880 (GRCm39) N159S probably benign Het
Fhad1 A G 4: 141,681,498 (GRCm39) I514T probably damaging Het
Fras1 A G 5: 96,929,443 (GRCm39) K3949R probably damaging Het
Gm10800 AAAGAAAACTGAA ACAAGAAAACTGAA 2: 98,497,378 (GRCm39) probably null Het
Grm3 T A 5: 9,639,880 (GRCm39) E55V probably benign Het
Itgbl1 G A 14: 124,210,735 (GRCm39) D478N possibly damaging Het
Kcnt2 T A 1: 140,282,247 (GRCm39) Y77* probably null Het
Kdm4c T C 4: 74,323,058 (GRCm39) S997P probably damaging Het
Kti12 A C 4: 108,705,443 (GRCm39) E119A probably benign Het
Kti12 G T 4: 108,705,444 (GRCm39) E119D probably benign Het
Lrrc28 T C 7: 67,268,857 (GRCm39) Y71C probably damaging Het
Lrrc45 T A 11: 120,606,706 (GRCm39) W203R probably benign Het
Lrrc66 A T 5: 73,765,835 (GRCm39) C403S possibly damaging Het
Ly6g6e A T 17: 35,296,894 (GRCm39) E45V probably damaging Het
Mgam C T 6: 40,735,985 (GRCm39) T1574I probably damaging Het
Msrb2 A T 2: 19,388,091 (GRCm39) M80L probably benign Het
Musk T A 4: 58,367,513 (GRCm39) L592Q probably damaging Het
Nlrp4a C A 7: 26,150,011 (GRCm39) N539K probably benign Het
Obscn C G 11: 59,003,381 (GRCm39) E1306Q probably benign Het
Opalin T A 19: 41,052,242 (GRCm39) *144C probably null Het
Or1e28-ps1 A G 11: 73,615,362 (GRCm39) S163P unknown Het
Or1l8 A G 2: 36,817,371 (GRCm39) F252L possibly damaging Het
Or4f4-ps1 A G 2: 111,330,166 (GRCm39) S190G probably damaging Het
Or9g4 T C 2: 85,504,907 (GRCm39) E196G Het
Pgam2 T A 11: 5,753,007 (GRCm39) H196L possibly damaging Het
Pgls T C 8: 72,044,996 (GRCm39) S46P probably damaging Het
Prrc2b A G 2: 32,094,127 (GRCm39) E503G probably damaging Het
Prss45 T C 9: 110,670,103 (GRCm39) L304P unknown Het
Rbm20 T A 19: 53,801,753 (GRCm39) V87D probably damaging Het
Rskr T C 11: 78,182,449 (GRCm39) L86P probably damaging Het
Serpinb8 T C 1: 107,526,715 (GRCm39) L85S probably benign Het
Sh2b2 A T 5: 136,253,115 (GRCm39) H352Q probably benign Het
Slc6a17 T C 3: 107,403,056 (GRCm39) I124V probably damaging Het
Smim10l1 G A 6: 133,082,545 (GRCm39) V31M probably damaging Het
Snx10 T C 6: 51,557,301 (GRCm39) S78P probably benign Het
Stard10 T C 7: 100,991,838 (GRCm39) V187A probably damaging Het
Svil C A 18: 5,118,357 (GRCm39) D2146E probably benign Het
Tsc22d4 A G 5: 137,749,627 (GRCm39) D301G probably null Het
Ube3c T A 5: 29,851,429 (GRCm39) I752N probably damaging Het
Wwc1 T C 11: 35,734,990 (GRCm39) M962V probably benign Het
Other mutations in Cdh20
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00428:Cdh20 APN 1 104,881,612 (GRCm39) missense probably benign 0.05
IGL00742:Cdh20 APN 1 109,993,356 (GRCm39) missense probably benign 0.22
IGL00743:Cdh20 APN 1 104,875,153 (GRCm39) missense probably benign 0.06
IGL00848:Cdh20 APN 1 104,861,981 (GRCm39) missense probably benign
IGL00861:Cdh20 APN 1 109,988,718 (GRCm39) splice site probably benign
IGL01016:Cdh20 APN 1 110,036,686 (GRCm39) critical splice donor site probably null
IGL01393:Cdh20 APN 1 104,861,969 (GRCm39) missense probably benign
IGL01396:Cdh20 APN 1 104,875,154 (GRCm39) missense possibly damaging 0.59
IGL01485:Cdh20 APN 1 104,861,832 (GRCm39) missense probably benign 0.05
IGL01538:Cdh20 APN 1 109,988,870 (GRCm39) missense probably damaging 1.00
IGL01612:Cdh20 APN 1 104,921,895 (GRCm39) missense probably benign 0.02
IGL01763:Cdh20 APN 1 109,993,520 (GRCm39) missense probably benign 0.00
IGL01765:Cdh20 APN 1 109,988,836 (GRCm39) missense probably damaging 1.00
IGL01937:Cdh20 APN 1 110,065,826 (GRCm39) missense probably benign
IGL01947:Cdh20 APN 1 104,921,649 (GRCm39) missense possibly damaging 0.91
IGL01967:Cdh20 APN 1 104,868,762 (GRCm39) missense probably damaging 1.00
IGL02020:Cdh20 APN 1 110,066,078 (GRCm39) missense probably damaging 1.00
IGL02135:Cdh20 APN 1 110,066,004 (GRCm39) nonsense probably null
IGL02226:Cdh20 APN 1 104,881,816 (GRCm39) splice site probably benign
IGL02285:Cdh20 APN 1 110,065,921 (GRCm39) missense probably damaging 1.00
IGL02318:Cdh20 APN 1 104,881,764 (GRCm39) missense probably null 0.03
IGL02326:Cdh20 APN 1 104,902,764 (GRCm39) missense probably damaging 0.97
IGL02798:Cdh20 APN 1 104,875,190 (GRCm39) missense probably damaging 0.97
IGL02963:Cdh20 APN 1 104,861,823 (GRCm39) start codon destroyed probably null 0.66
IGL03081:Cdh20 APN 1 104,868,982 (GRCm39) missense probably damaging 1.00
IGL03237:Cdh20 APN 1 110,066,037 (GRCm39) missense possibly damaging 0.89
IGL03280:Cdh20 APN 1 110,036,498 (GRCm39) nonsense probably null
IGL03347:Cdh20 APN 1 110,065,973 (GRCm39) missense possibly damaging 0.53
IGL03385:Cdh20 APN 1 109,993,516 (GRCm39) missense possibly damaging 0.90
3-1:Cdh20 UTSW 1 104,875,145 (GRCm39) missense possibly damaging 0.84
BB002:Cdh20 UTSW 1 104,912,473 (GRCm39) missense probably damaging 0.99
IGL02802:Cdh20 UTSW 1 110,065,655 (GRCm39) missense probably damaging 1.00
IGL02991:Cdh20 UTSW 1 104,861,972 (GRCm39) missense probably benign
R0030:Cdh20 UTSW 1 110,065,798 (GRCm39) nonsense probably null
R0070:Cdh20 UTSW 1 110,026,102 (GRCm39) missense probably benign 0.37
R0070:Cdh20 UTSW 1 110,026,102 (GRCm39) missense probably benign 0.37
R0178:Cdh20 UTSW 1 104,902,776 (GRCm39) missense possibly damaging 0.82
R0255:Cdh20 UTSW 1 109,922,036 (GRCm39) missense probably benign 0.09
R0365:Cdh20 UTSW 1 110,036,486 (GRCm39) missense probably damaging 1.00
R0506:Cdh20 UTSW 1 110,027,844 (GRCm39) missense probably damaging 1.00
R0549:Cdh20 UTSW 1 110,036,674 (GRCm39) missense probably damaging 1.00
R0599:Cdh20 UTSW 1 109,980,696 (GRCm39) missense probably damaging 1.00
R0648:Cdh20 UTSW 1 109,993,337 (GRCm39) splice site probably benign
R1033:Cdh20 UTSW 1 110,012,783 (GRCm39) missense probably damaging 0.96
R1114:Cdh20 UTSW 1 104,906,739 (GRCm39) missense probably damaging 0.96
R1173:Cdh20 UTSW 1 109,988,862 (GRCm39) missense probably benign 0.10
R1174:Cdh20 UTSW 1 109,988,862 (GRCm39) missense probably benign 0.10
R1175:Cdh20 UTSW 1 109,988,862 (GRCm39) missense probably benign 0.10
R1401:Cdh20 UTSW 1 104,875,222 (GRCm39) missense possibly damaging 0.65
R1403:Cdh20 UTSW 1 109,988,862 (GRCm39) missense probably benign 0.10
R1403:Cdh20 UTSW 1 109,988,862 (GRCm39) missense probably benign 0.10
R1406:Cdh20 UTSW 1 109,988,862 (GRCm39) missense probably benign 0.10
R1406:Cdh20 UTSW 1 109,988,862 (GRCm39) missense probably benign 0.10
R1502:Cdh20 UTSW 1 104,881,755 (GRCm39) missense probably benign 0.06
R1587:Cdh20 UTSW 1 110,027,757 (GRCm39) missense probably damaging 0.98
R1728:Cdh20 UTSW 1 109,993,465 (GRCm39) missense possibly damaging 0.53
R1729:Cdh20 UTSW 1 109,993,465 (GRCm39) missense possibly damaging 0.53
R1730:Cdh20 UTSW 1 109,993,465 (GRCm39) missense possibly damaging 0.53
R1739:Cdh20 UTSW 1 109,993,465 (GRCm39) missense possibly damaging 0.53
R1762:Cdh20 UTSW 1 109,993,465 (GRCm39) missense possibly damaging 0.53
R1764:Cdh20 UTSW 1 104,862,070 (GRCm39) splice site probably benign
R1769:Cdh20 UTSW 1 109,980,606 (GRCm39) missense probably damaging 1.00
R1783:Cdh20 UTSW 1 109,993,465 (GRCm39) missense possibly damaging 0.53
R1785:Cdh20 UTSW 1 109,993,465 (GRCm39) missense possibly damaging 0.53
R1940:Cdh20 UTSW 1 109,976,754 (GRCm39) missense probably benign 0.09
R1972:Cdh20 UTSW 1 109,988,862 (GRCm39) missense probably benign 0.10
R1973:Cdh20 UTSW 1 109,988,862 (GRCm39) missense probably benign 0.10
R1997:Cdh20 UTSW 1 109,976,668 (GRCm39) missense probably damaging 1.00
R2060:Cdh20 UTSW 1 109,976,607 (GRCm39) missense probably damaging 1.00
R2068:Cdh20 UTSW 1 110,065,666 (GRCm39) nonsense probably null
R2069:Cdh20 UTSW 1 110,065,889 (GRCm39) missense probably damaging 1.00
R2137:Cdh20 UTSW 1 110,027,836 (GRCm39) missense probably damaging 0.97
R2155:Cdh20 UTSW 1 109,976,594 (GRCm39) missense probably damaging 1.00
R2198:Cdh20 UTSW 1 104,875,047 (GRCm39) critical splice acceptor site probably null
R2279:Cdh20 UTSW 1 104,875,139 (GRCm39) missense probably damaging 1.00
R2419:Cdh20 UTSW 1 104,902,740 (GRCm39) missense possibly damaging 0.92
R2897:Cdh20 UTSW 1 104,875,199 (GRCm39) missense probably damaging 1.00
R3780:Cdh20 UTSW 1 109,976,734 (GRCm39) missense probably benign 0.45
R3781:Cdh20 UTSW 1 109,976,734 (GRCm39) missense probably benign 0.45
R3782:Cdh20 UTSW 1 109,976,734 (GRCm39) missense probably benign 0.45
R4115:Cdh20 UTSW 1 110,066,039 (GRCm39) missense probably benign 0.37
R4243:Cdh20 UTSW 1 104,869,868 (GRCm39) missense probably damaging 1.00
R4244:Cdh20 UTSW 1 104,869,868 (GRCm39) missense probably damaging 1.00
R4277:Cdh20 UTSW 1 109,993,418 (GRCm39) missense probably benign 0.00
R4299:Cdh20 UTSW 1 109,988,731 (GRCm39) missense probably damaging 0.99
R4349:Cdh20 UTSW 1 104,906,814 (GRCm39) missense probably damaging 1.00
R4350:Cdh20 UTSW 1 104,906,814 (GRCm39) missense probably damaging 1.00
R4352:Cdh20 UTSW 1 104,906,814 (GRCm39) missense probably damaging 1.00
R4353:Cdh20 UTSW 1 104,906,814 (GRCm39) missense probably damaging 1.00
R4719:Cdh20 UTSW 1 104,862,035 (GRCm39) missense probably damaging 0.97
R4754:Cdh20 UTSW 1 104,912,410 (GRCm39) missense probably damaging 0.99
R4777:Cdh20 UTSW 1 109,922,055 (GRCm39) nonsense probably null
R4795:Cdh20 UTSW 1 104,868,989 (GRCm39) missense probably damaging 1.00
R4796:Cdh20 UTSW 1 104,868,989 (GRCm39) missense probably damaging 1.00
R4907:Cdh20 UTSW 1 110,066,053 (GRCm39) missense probably damaging 1.00
R4955:Cdh20 UTSW 1 104,912,528 (GRCm39) missense probably damaging 1.00
R5045:Cdh20 UTSW 1 110,026,080 (GRCm39) missense probably benign 0.01
R5056:Cdh20 UTSW 1 104,881,722 (GRCm39) missense probably benign 0.00
R5059:Cdh20 UTSW 1 109,993,430 (GRCm39) missense probably damaging 0.98
R5127:Cdh20 UTSW 1 104,875,073 (GRCm39) missense probably damaging 1.00
R5146:Cdh20 UTSW 1 109,922,042 (GRCm39) missense probably damaging 0.97
R5196:Cdh20 UTSW 1 110,065,730 (GRCm39) missense probably damaging 0.99
R5269:Cdh20 UTSW 1 104,861,882 (GRCm39) missense possibly damaging 0.67
R5304:Cdh20 UTSW 1 110,036,569 (GRCm39) missense probably damaging 1.00
R5496:Cdh20 UTSW 1 109,976,647 (GRCm39) missense probably damaging 1.00
R5563:Cdh20 UTSW 1 104,875,082 (GRCm39) missense probably benign 0.29
R5634:Cdh20 UTSW 1 104,902,800 (GRCm39) missense probably damaging 0.97
R5708:Cdh20 UTSW 1 104,912,635 (GRCm39) missense probably damaging 1.00
R5743:Cdh20 UTSW 1 110,036,575 (GRCm39) missense probably damaging 1.00
R5822:Cdh20 UTSW 1 104,861,823 (GRCm39) start codon destroyed probably null 0.49
R5867:Cdh20 UTSW 1 109,976,581 (GRCm39) missense probably damaging 1.00
R5933:Cdh20 UTSW 1 104,912,396 (GRCm39) missense probably damaging 1.00
R6042:Cdh20 UTSW 1 110,065,997 (GRCm39) missense probably damaging 0.97
R6092:Cdh20 UTSW 1 110,026,036 (GRCm39) missense probably benign 0.00
R6109:Cdh20 UTSW 1 104,921,739 (GRCm39) missense probably damaging 1.00
R6497:Cdh20 UTSW 1 109,993,528 (GRCm39) critical splice donor site probably null
R6521:Cdh20 UTSW 1 104,869,859 (GRCm39) missense probably damaging 1.00
R6911:Cdh20 UTSW 1 104,912,411 (GRCm39) missense possibly damaging 0.95
R7111:Cdh20 UTSW 1 110,065,638 (GRCm39) missense
R7169:Cdh20 UTSW 1 104,875,078 (GRCm39) missense possibly damaging 0.91
R7207:Cdh20 UTSW 1 104,921,702 (GRCm39) missense probably damaging 0.98
R7208:Cdh20 UTSW 1 104,881,796 (GRCm39) missense possibly damaging 0.63
R7297:Cdh20 UTSW 1 104,898,598 (GRCm39) missense probably benign
R7511:Cdh20 UTSW 1 109,925,583 (GRCm39) intron probably benign
R7532:Cdh20 UTSW 1 110,065,889 (GRCm39) missense probably damaging 1.00
R7535:Cdh20 UTSW 1 104,902,768 (GRCm39) missense probably damaging 1.00
R7587:Cdh20 UTSW 1 104,869,004 (GRCm39) missense probably damaging 1.00
R7748:Cdh20 UTSW 1 104,869,024 (GRCm39) missense probably damaging 1.00
R7879:Cdh20 UTSW 1 109,976,677 (GRCm39) missense probably benign 0.01
R7879:Cdh20 UTSW 1 104,875,047 (GRCm39) critical splice acceptor site probably null
R7915:Cdh20 UTSW 1 104,861,898 (GRCm39) missense probably benign 0.15
R7925:Cdh20 UTSW 1 104,912,473 (GRCm39) missense probably damaging 0.99
R7978:Cdh20 UTSW 1 109,921,835 (GRCm39) start gained probably benign
R8022:Cdh20 UTSW 1 109,988,838 (GRCm39) missense probably benign 0.02
R8207:Cdh20 UTSW 1 109,922,076 (GRCm39) missense probably damaging 1.00
R8224:Cdh20 UTSW 1 109,921,933 (GRCm39) missense probably benign
R8239:Cdh20 UTSW 1 110,027,832 (GRCm39) missense probably benign 0.11
R8257:Cdh20 UTSW 1 104,921,962 (GRCm39) missense probably benign 0.25
R8444:Cdh20 UTSW 1 104,898,583 (GRCm39) missense probably benign 0.16
R8546:Cdh20 UTSW 1 104,861,769 (GRCm39) start gained probably benign
R8749:Cdh20 UTSW 1 110,027,009 (GRCm39) missense probably damaging 1.00
R8870:Cdh20 UTSW 1 104,873,048 (GRCm39) missense probably damaging 0.99
R8884:Cdh20 UTSW 1 110,027,860 (GRCm39) missense probably damaging 1.00
R9030:Cdh20 UTSW 1 110,027,843 (GRCm39) missense probably benign 0.21
R9310:Cdh20 UTSW 1 104,875,061 (GRCm39) missense probably damaging 1.00
R9498:Cdh20 UTSW 1 109,976,635 (GRCm39) missense probably benign 0.03
R9542:Cdh20 UTSW 1 104,875,067 (GRCm39) missense probably damaging 1.00
R9602:Cdh20 UTSW 1 104,868,823 (GRCm39) missense probably benign 0.07
R9658:Cdh20 UTSW 1 109,988,785 (GRCm39) missense probably damaging 0.99
R9664:Cdh20 UTSW 1 104,862,065 (GRCm39) missense probably benign 0.10
Z1088:Cdh20 UTSW 1 110,012,853 (GRCm39) missense probably benign 0.01
Z1176:Cdh20 UTSW 1 110,036,466 (GRCm39) missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- ACCAATAGACATGGCTGCGG -3'
(R):5'- AGCCGCTAACTCACCTAAGAGG -3'

Sequencing Primer
(F):5'- GGCAGTGCACGCCTTATAAC -3'
(R):5'- TCACCTAAGAGGACAAAGATGC -3'
Posted On 2020-08-01