Incidental Mutation 'R2419:Cdh20'
ID 249115
Institutional Source Beutler Lab
Gene Symbol Cdh20
Ensembl Gene ENSMUSG00000050840
Gene Name cadherin 20
Synonyms Cdh7
MMRRC Submission 040381-MU
Accession Numbers
Essential gene? Possibly non essential (E-score: 0.301) question?
Stock # R2419 (G1)
Quality Score 225
Status Validated
Chromosome 1
Chromosomal Location 104696254-104923206 bp(+) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) G to A at 104902740 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Serine to Asparagine at position 477 (S477N)
Ref Sequence ENSEMBL: ENSMUSP00000052078 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000062528]
AlphaFold Q9Z0M3
Predicted Effect possibly damaging
Transcript: ENSMUST00000062528
AA Change: S477N

PolyPhen 2 Score 0.919 (Sensitivity: 0.81; Specificity: 0.94)
SMART Domains Protein: ENSMUSP00000052078
Gene: ENSMUSG00000050840
AA Change: S477N

DomainStartEndE-ValueType
transmembrane domain 12 34 N/A INTRINSIC
CA 82 163 1.01e-15 SMART
CA 187 272 1.35e-30 SMART
CA 296 388 1.98e-14 SMART
CA 411 492 1.61e-23 SMART
CA 515 602 3.9e-13 SMART
transmembrane domain 620 642 N/A INTRINSIC
Pfam:Cadherin_C 645 793 2.6e-49 PFAM
Meta Mutation Damage Score 0.1127 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.6%
  • 10x: 97.2%
  • 20x: 94.9%
Validation Efficiency 98% (57/58)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene is a type II classical cadherin from the cadherin superfamily and one of three cadherin 7-like genes located in a cluster on chromosome 18. The encoded membrane protein is a calcium dependent cell-cell adhesion glycoprotein comprised of five extracellular cadherin repeats, a transmembrane region and a highly conserved cytoplasmic tail. Type II (atypical) cadherins are defined based on their lack of a HAV cell adhesion recognition sequence specific to type I cadherins. Since disturbance of intracellular adhesion is a prerequisite for invasion and metastasis of tumor cells, cadherins are considered prime candidates for tumor suppressor genes. [provided by RefSeq, Jul 2008]
Allele List at MGI

All alleles(1) : Targeted, other(1)

Other mutations in this stock
Total: 59 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abca2 G A 2: 25,328,001 (GRCm39) A768T probably benign Het
Acyp2 T C 11: 30,582,316 (GRCm39) Y33C probably benign Het
Ampd3 A G 7: 110,367,576 (GRCm39) probably benign Het
Arap3 T C 18: 38,122,997 (GRCm39) D501G probably damaging Het
Arl4d A T 11: 101,557,714 (GRCm39) Q80L probably damaging Het
Bcorl1 A G X: 47,459,418 (GRCm39) T425A probably damaging Het
Ccdc38 T A 10: 93,384,837 (GRCm39) V35D probably benign Het
Cd6 G A 19: 10,770,216 (GRCm39) P492S probably damaging Het
Cnmd G A 14: 79,875,488 (GRCm39) P311S probably damaging Het
Cnot8 G A 11: 58,006,136 (GRCm39) G222R probably damaging Het
Dnah9 A T 11: 65,986,241 (GRCm39) L1131* probably null Het
Dscc1 G A 15: 54,946,820 (GRCm39) R302* probably null Het
Dusp18 T C 11: 3,847,018 (GRCm39) S3P possibly damaging Het
Eml2 A G 7: 18,910,620 (GRCm39) probably benign Het
Foxb2 G C 19: 16,850,325 (GRCm39) A227G probably damaging Het
Hey1 A G 3: 8,731,003 (GRCm39) probably null Het
Itk A G 11: 46,229,044 (GRCm39) F379L probably damaging Het
Kcna2 G A 3: 107,011,469 (GRCm39) G17R probably benign Het
Kif7 C A 7: 79,348,441 (GRCm39) R1300L probably benign Het
Klkb1 A T 8: 45,742,149 (GRCm39) D43E possibly damaging Het
Leng9 A G 7: 4,151,626 (GRCm39) V350A probably benign Het
Lmbr1l A C 15: 98,805,418 (GRCm39) F361C possibly damaging Het
Lrat A G 3: 82,810,992 (GRCm39) S10P probably damaging Het
Lrrk2 C A 15: 91,681,729 (GRCm39) probably benign Het
Mcur1 C T 13: 43,703,013 (GRCm39) V241M possibly damaging Het
Met T C 6: 17,535,829 (GRCm39) probably benign Het
Mical3 A G 6: 120,936,884 (GRCm39) V342A probably benign Het
Nup210 G A 6: 90,994,538 (GRCm39) probably benign Het
Or1i2 T A 10: 78,448,221 (GRCm39) I85F probably benign Het
Or1j12 T A 2: 36,343,338 (GRCm39) V247E probably damaging Het
Or4c107 A G 2: 88,789,380 (GRCm39) N190S probably benign Het
Pcdhac1 T C 18: 37,224,381 (GRCm39) L398P probably benign Het
Phc3 T C 3: 31,005,027 (GRCm39) M189V probably damaging Het
Plcb1 A G 2: 135,104,020 (GRCm39) probably benign Het
Plcxd3 G T 15: 4,604,245 (GRCm39) K284N probably benign Het
Plxnb2 A G 15: 89,045,272 (GRCm39) V1058A possibly damaging Het
Rbbp5 T C 1: 132,421,564 (GRCm39) I88T possibly damaging Het
Rfpl4b T C 10: 38,697,368 (GRCm39) R78G probably benign Het
Rsf1 CG CGACGGCGGGG 7: 97,229,115 (GRCm39) probably benign Het
Samt2 A T X: 153,358,223 (GRCm39) probably null Het
Sdad1 T C 5: 92,453,677 (GRCm39) H37R possibly damaging Het
Setd2 T A 9: 110,378,065 (GRCm39) F627I possibly damaging Het
Ski A G 4: 155,245,350 (GRCm39) S293P probably benign Het
Slc27a1 A G 8: 72,032,560 (GRCm39) E191G possibly damaging Het
Snx18 T C 13: 113,753,755 (GRCm39) M393V possibly damaging Het
Spata31g1 A G 4: 42,974,146 (GRCm39) T1160A possibly damaging Het
Tacc1 A G 8: 25,672,829 (GRCm39) V42A possibly damaging Het
Tbc1d8 A G 1: 39,415,983 (GRCm39) F897L probably damaging Het
Tenm3 C T 8: 48,729,693 (GRCm39) D1438N possibly damaging Het
Tmem62 G A 2: 120,837,586 (GRCm39) G501E probably damaging Het
Tmem94 A G 11: 115,687,641 (GRCm39) K1167E probably damaging Het
Trap1 A G 16: 3,886,194 (GRCm39) S88P probably benign Het
Ugt2b38 T C 5: 87,571,591 (GRCm39) D147G probably damaging Het
Vmn1r168 A T 7: 23,240,824 (GRCm39) N227I probably benign Het
Vmn1r203 T A 13: 22,709,004 (GRCm39) S262T possibly damaging Het
Vmn1r204 T G 13: 22,740,420 (GRCm39) L17R probably damaging Het
Zcchc14 T A 8: 122,330,675 (GRCm39) Q896L probably damaging Het
Zfp619 A G 7: 39,185,307 (GRCm39) K446E possibly damaging Het
Zpr1 T C 9: 46,187,490 (GRCm39) probably benign Het
Other mutations in Cdh20
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00428:Cdh20 APN 1 104,881,612 (GRCm39) missense probably benign 0.05
IGL00742:Cdh20 APN 1 109,993,356 (GRCm39) missense probably benign 0.22
IGL00743:Cdh20 APN 1 104,875,153 (GRCm39) missense probably benign 0.06
IGL00848:Cdh20 APN 1 104,861,981 (GRCm39) missense probably benign
IGL00861:Cdh20 APN 1 109,988,718 (GRCm39) splice site probably benign
IGL01016:Cdh20 APN 1 110,036,686 (GRCm39) critical splice donor site probably null
IGL01393:Cdh20 APN 1 104,861,969 (GRCm39) missense probably benign
IGL01396:Cdh20 APN 1 104,875,154 (GRCm39) missense possibly damaging 0.59
IGL01485:Cdh20 APN 1 104,861,832 (GRCm39) missense probably benign 0.05
IGL01538:Cdh20 APN 1 109,988,870 (GRCm39) missense probably damaging 1.00
IGL01612:Cdh20 APN 1 104,921,895 (GRCm39) missense probably benign 0.02
IGL01763:Cdh20 APN 1 109,993,520 (GRCm39) missense probably benign 0.00
IGL01765:Cdh20 APN 1 109,988,836 (GRCm39) missense probably damaging 1.00
IGL01937:Cdh20 APN 1 110,065,826 (GRCm39) missense probably benign
IGL01947:Cdh20 APN 1 104,921,649 (GRCm39) missense possibly damaging 0.91
IGL01967:Cdh20 APN 1 104,868,762 (GRCm39) missense probably damaging 1.00
IGL02020:Cdh20 APN 1 110,066,078 (GRCm39) missense probably damaging 1.00
IGL02135:Cdh20 APN 1 110,066,004 (GRCm39) nonsense probably null
IGL02226:Cdh20 APN 1 104,881,816 (GRCm39) splice site probably benign
IGL02285:Cdh20 APN 1 110,065,921 (GRCm39) missense probably damaging 1.00
IGL02318:Cdh20 APN 1 104,881,764 (GRCm39) missense probably null 0.03
IGL02326:Cdh20 APN 1 104,902,764 (GRCm39) missense probably damaging 0.97
IGL02798:Cdh20 APN 1 104,875,190 (GRCm39) missense probably damaging 0.97
IGL02963:Cdh20 APN 1 104,861,823 (GRCm39) start codon destroyed probably null 0.66
IGL03081:Cdh20 APN 1 104,868,982 (GRCm39) missense probably damaging 1.00
IGL03237:Cdh20 APN 1 110,066,037 (GRCm39) missense possibly damaging 0.89
IGL03280:Cdh20 APN 1 110,036,498 (GRCm39) nonsense probably null
IGL03347:Cdh20 APN 1 110,065,973 (GRCm39) missense possibly damaging 0.53
IGL03385:Cdh20 APN 1 109,993,516 (GRCm39) missense possibly damaging 0.90
3-1:Cdh20 UTSW 1 104,875,145 (GRCm39) missense possibly damaging 0.84
BB002:Cdh20 UTSW 1 104,912,473 (GRCm39) missense probably damaging 0.99
BB012:Cdh20 UTSW 1 104,912,473 (GRCm39) missense probably damaging 0.99
IGL02802:Cdh20 UTSW 1 110,065,655 (GRCm39) missense probably damaging 1.00
IGL02991:Cdh20 UTSW 1 104,861,972 (GRCm39) missense probably benign
R0030:Cdh20 UTSW 1 110,065,798 (GRCm39) nonsense probably null
R0070:Cdh20 UTSW 1 110,026,102 (GRCm39) missense probably benign 0.37
R0070:Cdh20 UTSW 1 110,026,102 (GRCm39) missense probably benign 0.37
R0178:Cdh20 UTSW 1 104,902,776 (GRCm39) missense possibly damaging 0.82
R0255:Cdh20 UTSW 1 109,922,036 (GRCm39) missense probably benign 0.09
R0365:Cdh20 UTSW 1 110,036,486 (GRCm39) missense probably damaging 1.00
R0506:Cdh20 UTSW 1 110,027,844 (GRCm39) missense probably damaging 1.00
R0549:Cdh20 UTSW 1 110,036,674 (GRCm39) missense probably damaging 1.00
R0599:Cdh20 UTSW 1 109,980,696 (GRCm39) missense probably damaging 1.00
R0648:Cdh20 UTSW 1 109,993,337 (GRCm39) splice site probably benign
R1033:Cdh20 UTSW 1 110,012,783 (GRCm39) missense probably damaging 0.96
R1114:Cdh20 UTSW 1 104,906,739 (GRCm39) missense probably damaging 0.96
R1173:Cdh20 UTSW 1 109,988,862 (GRCm39) missense probably benign 0.10
R1174:Cdh20 UTSW 1 109,988,862 (GRCm39) missense probably benign 0.10
R1175:Cdh20 UTSW 1 109,988,862 (GRCm39) missense probably benign 0.10
R1401:Cdh20 UTSW 1 104,875,222 (GRCm39) missense possibly damaging 0.65
R1403:Cdh20 UTSW 1 109,988,862 (GRCm39) missense probably benign 0.10
R1403:Cdh20 UTSW 1 109,988,862 (GRCm39) missense probably benign 0.10
R1406:Cdh20 UTSW 1 109,988,862 (GRCm39) missense probably benign 0.10
R1406:Cdh20 UTSW 1 109,988,862 (GRCm39) missense probably benign 0.10
R1502:Cdh20 UTSW 1 104,881,755 (GRCm39) missense probably benign 0.06
R1587:Cdh20 UTSW 1 110,027,757 (GRCm39) missense probably damaging 0.98
R1728:Cdh20 UTSW 1 109,993,465 (GRCm39) missense possibly damaging 0.53
R1729:Cdh20 UTSW 1 109,993,465 (GRCm39) missense possibly damaging 0.53
R1730:Cdh20 UTSW 1 109,993,465 (GRCm39) missense possibly damaging 0.53
R1739:Cdh20 UTSW 1 109,993,465 (GRCm39) missense possibly damaging 0.53
R1762:Cdh20 UTSW 1 109,993,465 (GRCm39) missense possibly damaging 0.53
R1764:Cdh20 UTSW 1 104,862,070 (GRCm39) splice site probably benign
R1769:Cdh20 UTSW 1 109,980,606 (GRCm39) missense probably damaging 1.00
R1783:Cdh20 UTSW 1 109,993,465 (GRCm39) missense possibly damaging 0.53
R1785:Cdh20 UTSW 1 109,993,465 (GRCm39) missense possibly damaging 0.53
R1940:Cdh20 UTSW 1 109,976,754 (GRCm39) missense probably benign 0.09
R1972:Cdh20 UTSW 1 109,988,862 (GRCm39) missense probably benign 0.10
R1973:Cdh20 UTSW 1 109,988,862 (GRCm39) missense probably benign 0.10
R1997:Cdh20 UTSW 1 109,976,668 (GRCm39) missense probably damaging 1.00
R2060:Cdh20 UTSW 1 109,976,607 (GRCm39) missense probably damaging 1.00
R2068:Cdh20 UTSW 1 110,065,666 (GRCm39) nonsense probably null
R2069:Cdh20 UTSW 1 110,065,889 (GRCm39) missense probably damaging 1.00
R2137:Cdh20 UTSW 1 110,027,836 (GRCm39) missense probably damaging 0.97
R2155:Cdh20 UTSW 1 109,976,594 (GRCm39) missense probably damaging 1.00
R2198:Cdh20 UTSW 1 104,875,047 (GRCm39) critical splice acceptor site probably null
R2279:Cdh20 UTSW 1 104,875,139 (GRCm39) missense probably damaging 1.00
R2897:Cdh20 UTSW 1 104,875,199 (GRCm39) missense probably damaging 1.00
R3780:Cdh20 UTSW 1 109,976,734 (GRCm39) missense probably benign 0.45
R3781:Cdh20 UTSW 1 109,976,734 (GRCm39) missense probably benign 0.45
R3782:Cdh20 UTSW 1 109,976,734 (GRCm39) missense probably benign 0.45
R4115:Cdh20 UTSW 1 110,066,039 (GRCm39) missense probably benign 0.37
R4243:Cdh20 UTSW 1 104,869,868 (GRCm39) missense probably damaging 1.00
R4244:Cdh20 UTSW 1 104,869,868 (GRCm39) missense probably damaging 1.00
R4277:Cdh20 UTSW 1 109,993,418 (GRCm39) missense probably benign 0.00
R4299:Cdh20 UTSW 1 109,988,731 (GRCm39) missense probably damaging 0.99
R4349:Cdh20 UTSW 1 104,906,814 (GRCm39) missense probably damaging 1.00
R4350:Cdh20 UTSW 1 104,906,814 (GRCm39) missense probably damaging 1.00
R4352:Cdh20 UTSW 1 104,906,814 (GRCm39) missense probably damaging 1.00
R4353:Cdh20 UTSW 1 104,906,814 (GRCm39) missense probably damaging 1.00
R4719:Cdh20 UTSW 1 104,862,035 (GRCm39) missense probably damaging 0.97
R4754:Cdh20 UTSW 1 104,912,410 (GRCm39) missense probably damaging 0.99
R4777:Cdh20 UTSW 1 109,922,055 (GRCm39) nonsense probably null
R4795:Cdh20 UTSW 1 104,868,989 (GRCm39) missense probably damaging 1.00
R4796:Cdh20 UTSW 1 104,868,989 (GRCm39) missense probably damaging 1.00
R4907:Cdh20 UTSW 1 110,066,053 (GRCm39) missense probably damaging 1.00
R4955:Cdh20 UTSW 1 104,912,528 (GRCm39) missense probably damaging 1.00
R5045:Cdh20 UTSW 1 110,026,080 (GRCm39) missense probably benign 0.01
R5056:Cdh20 UTSW 1 104,881,722 (GRCm39) missense probably benign 0.00
R5059:Cdh20 UTSW 1 109,993,430 (GRCm39) missense probably damaging 0.98
R5127:Cdh20 UTSW 1 104,875,073 (GRCm39) missense probably damaging 1.00
R5146:Cdh20 UTSW 1 109,922,042 (GRCm39) missense probably damaging 0.97
R5196:Cdh20 UTSW 1 110,065,730 (GRCm39) missense probably damaging 0.99
R5269:Cdh20 UTSW 1 104,861,882 (GRCm39) missense possibly damaging 0.67
R5304:Cdh20 UTSW 1 110,036,569 (GRCm39) missense probably damaging 1.00
R5496:Cdh20 UTSW 1 109,976,647 (GRCm39) missense probably damaging 1.00
R5563:Cdh20 UTSW 1 104,875,082 (GRCm39) missense probably benign 0.29
R5634:Cdh20 UTSW 1 104,902,800 (GRCm39) missense probably damaging 0.97
R5708:Cdh20 UTSW 1 104,912,635 (GRCm39) missense probably damaging 1.00
R5743:Cdh20 UTSW 1 110,036,575 (GRCm39) missense probably damaging 1.00
R5822:Cdh20 UTSW 1 104,861,823 (GRCm39) start codon destroyed probably null 0.49
R5867:Cdh20 UTSW 1 109,976,581 (GRCm39) missense probably damaging 1.00
R5933:Cdh20 UTSW 1 104,912,396 (GRCm39) missense probably damaging 1.00
R6042:Cdh20 UTSW 1 110,065,997 (GRCm39) missense probably damaging 0.97
R6092:Cdh20 UTSW 1 110,026,036 (GRCm39) missense probably benign 0.00
R6109:Cdh20 UTSW 1 104,921,739 (GRCm39) missense probably damaging 1.00
R6497:Cdh20 UTSW 1 109,993,528 (GRCm39) critical splice donor site probably null
R6521:Cdh20 UTSW 1 104,869,859 (GRCm39) missense probably damaging 1.00
R6911:Cdh20 UTSW 1 104,912,411 (GRCm39) missense possibly damaging 0.95
R7111:Cdh20 UTSW 1 110,065,638 (GRCm39) missense
R7169:Cdh20 UTSW 1 104,875,078 (GRCm39) missense possibly damaging 0.91
R7207:Cdh20 UTSW 1 104,921,702 (GRCm39) missense probably damaging 0.98
R7208:Cdh20 UTSW 1 104,881,796 (GRCm39) missense possibly damaging 0.63
R7297:Cdh20 UTSW 1 104,898,598 (GRCm39) missense probably benign
R7511:Cdh20 UTSW 1 109,925,583 (GRCm39) intron probably benign
R7532:Cdh20 UTSW 1 110,065,889 (GRCm39) missense probably damaging 1.00
R7535:Cdh20 UTSW 1 104,902,768 (GRCm39) missense probably damaging 1.00
R7587:Cdh20 UTSW 1 104,869,004 (GRCm39) missense probably damaging 1.00
R7748:Cdh20 UTSW 1 104,869,024 (GRCm39) missense probably damaging 1.00
R7879:Cdh20 UTSW 1 109,976,677 (GRCm39) missense probably benign 0.01
R7879:Cdh20 UTSW 1 104,875,047 (GRCm39) critical splice acceptor site probably null
R7915:Cdh20 UTSW 1 104,861,898 (GRCm39) missense probably benign 0.15
R7925:Cdh20 UTSW 1 104,912,473 (GRCm39) missense probably damaging 0.99
R7978:Cdh20 UTSW 1 109,921,835 (GRCm39) start gained probably benign
R8022:Cdh20 UTSW 1 109,988,838 (GRCm39) missense probably benign 0.02
R8207:Cdh20 UTSW 1 109,922,076 (GRCm39) missense probably damaging 1.00
R8224:Cdh20 UTSW 1 109,921,933 (GRCm39) missense probably benign
R8239:Cdh20 UTSW 1 110,027,832 (GRCm39) missense probably benign 0.11
R8257:Cdh20 UTSW 1 104,921,962 (GRCm39) missense probably benign 0.25
R8444:Cdh20 UTSW 1 104,898,583 (GRCm39) missense probably benign 0.16
R8546:Cdh20 UTSW 1 104,861,769 (GRCm39) start gained probably benign
R8749:Cdh20 UTSW 1 110,027,009 (GRCm39) missense probably damaging 1.00
R8870:Cdh20 UTSW 1 104,873,048 (GRCm39) missense probably damaging 0.99
R8884:Cdh20 UTSW 1 110,027,860 (GRCm39) missense probably damaging 1.00
R9030:Cdh20 UTSW 1 110,027,843 (GRCm39) missense probably benign 0.21
R9310:Cdh20 UTSW 1 104,875,061 (GRCm39) missense probably damaging 1.00
R9498:Cdh20 UTSW 1 109,976,635 (GRCm39) missense probably benign 0.03
R9542:Cdh20 UTSW 1 104,875,067 (GRCm39) missense probably damaging 1.00
R9602:Cdh20 UTSW 1 104,868,823 (GRCm39) missense probably benign 0.07
R9658:Cdh20 UTSW 1 109,988,785 (GRCm39) missense probably damaging 0.99
R9664:Cdh20 UTSW 1 104,862,065 (GRCm39) missense probably benign 0.10
Z1088:Cdh20 UTSW 1 110,012,853 (GRCm39) missense probably benign 0.01
Z1176:Cdh20 UTSW 1 110,036,466 (GRCm39) missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- GCATGGTTACACTCTCAACAGGG -3'
(R):5'- CATACTTTCTGGTGTGGACATGATG -3'

Sequencing Primer
(F):5'- CAGGGAACACATGTCCTATGCG -3'
(R):5'- TTCCATGGCCTCTGAAAGAG -3'
Posted On 2014-11-12