Incidental Mutation 'R8326:Heatr5a'
ID644123
Institutional Source Beutler Lab
Gene Symbol Heatr5a
Ensembl Gene ENSMUSG00000035181
Gene NameHEAT repeat containing 5A
SynonymsD930036F22Rik
MMRRC Submission
Accession Numbers
Is this an essential gene? Possibly non essential (E-score: 0.263) question?
Stock #R8326 (G1)
Quality Score108.491
Status Not validated
Chromosome12
Chromosomal Location51875871-51971321 bp(-) (GRCm38)
Type of Mutationcritical splice donor site
DNA Base Change (assembly) AGCACACTGCAGGAAGCTCACACAGCACAGCATACCTTCAGGAGTGCACACTGCAGGAAGCTCACACAGCACAGCATACCTTCAGGAGAGCACACTGCAGGAAGCTCA to AGCACACTGCAGGAAGCTCACACAGCACAGCATACCTTCAGGAGAGCACACTGCAGGAAGCTCA at 51887919 bp
ZygosityHeterozygous
Amino Acid Change
Ref Sequence ENSEMBL: ENSMUSP00000043115 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000040583]
Predicted Effect probably benign
Transcript: ENSMUST00000040583
SMART Domains Protein: ENSMUSP00000043115
Gene: ENSMUSG00000035181

DomainStartEndE-ValueType
low complexity region 56 67 N/A INTRINSIC
SCOP:d1qbkb_ 112 658 6e-13 SMART
low complexity region 1063 1078 N/A INTRINSIC
low complexity region 1081 1095 N/A INTRINSIC
low complexity region 1110 1120 N/A INTRINSIC
low complexity region 1122 1135 N/A INTRINSIC
low complexity region 1496 1507 N/A INTRINSIC
low complexity region 1722 1735 N/A INTRINSIC
low complexity region 1925 1936 N/A INTRINSIC
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.4%
  • 20x: 98.2%
Validation Efficiency
Allele List at MGI
Other mutations in this stock
Total: 53 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Adgrl2 T C 3: 148,827,554 T35A Het
Adgrv1 C T 13: 81,445,343 R4175H probably damaging Het
AI314180 G T 4: 58,847,093 Q490K probably damaging Het
Akt3 T C 1: 177,050,045 N386D possibly damaging Het
Aox2 A T 1: 58,295,887 H282L probably benign Het
Asb7 G T 7: 66,659,927 N180K possibly damaging Het
Cdh23 T C 10: 60,438,812 S500G possibly damaging Het
Cubn C T 2: 13,306,463 E3084K probably benign Het
Cyp2r1 G A 7: 114,553,170 T184I probably damaging Het
Dclk3 A G 9: 111,467,534 R49G probably damaging Het
Dcp1a C T 14: 30,519,570 Q446* probably null Het
Dnah9 A G 11: 66,117,626 I791T probably benign Het
Dock10 A T 1: 80,606,175 V189D possibly damaging Het
Dsg4 A G 18: 20,449,731 E142G probably benign Het
Dsp A T 13: 38,191,635 D1132V probably damaging Het
Dync2h1 A G 9: 7,147,771 M953T probably benign Het
Ero1l T C 14: 45,294,348 H251R probably damaging Het
Fer1l5 A G 1: 36,376,760 Y124C probably benign Het
Frmpd2 C A 14: 33,511,035 P404Q probably damaging Het
Gpr87 G T 3: 59,194,974 probably benign Het
Gse1 T C 8: 120,578,580 Y1217H unknown Het
Irf9 T A 14: 55,605,753 D137E probably benign Het
Jup G T 11: 100,381,745 N280K probably benign Het
Kcna7 T C 7: 45,409,341 F351L probably damaging Het
Klk13 A T 7: 43,726,712 R270S probably benign Het
Msh6 C T 17: 87,986,912 R1032C probably damaging Het
Myo5a T C 9: 75,217,989 V1855A probably damaging Het
Neb T C 2: 52,221,702 T138A probably damaging Het
Nfkbie C A 17: 45,559,308 T193K probably damaging Het
Nlrp4b A G 7: 10,718,544 K613E probably benign Het
Obox6 T C 7: 15,833,556 E322G possibly damaging Het
Olfr111 T G 17: 37,530,579 S201A probably benign Het
Olfr632 A G 7: 103,937,602 D74G probably damaging Het
Olfr883 T C 9: 38,026,718 M304T probably benign Het
Parn A T 16: 13,665,971 N36K probably benign Het
Ppp6r2 A G 15: 89,280,447 E618G probably benign Het
Prdm13 A G 4: 21,679,557 L311P unknown Het
Prkaa2 T C 4: 105,036,298 T485A possibly damaging Het
Prmt2 G T 10: 76,217,413 T256K probably benign Het
Rspry1 T C 8: 94,639,589 Y362H probably damaging Het
Slc16a14 A T 1: 84,912,345 I413N possibly damaging Het
Slc8a1 T C 17: 81,408,106 T821A probably damaging Het
Spock2 A T 10: 60,126,955 K276N probably damaging Het
Synj1 A T 16: 90,988,196 N257K probably benign Het
Taar7f T C 10: 24,049,913 L135P possibly damaging Het
Tmem132b T C 5: 125,787,554 F908S probably damaging Het
Tmem202 A T 9: 59,519,217 V222D probably benign Het
Trim33 T A 3: 103,311,454 C302* probably null Het
Tuba4a G A 1: 75,218,621 S1L Het
Tyrp1 G A 4: 80,850,684 E472K probably benign Het
V1ra8 A G 6: 90,203,264 I150V possibly damaging Het
Vmn2r87 A T 10: 130,472,311 M686K possibly damaging Het
Zscan5b C T 7: 6,233,947 P232S possibly damaging Het
Other mutations in Heatr5a
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00339:Heatr5a APN 12 51888901 missense probably damaging 0.99
IGL01397:Heatr5a APN 12 51894369 missense possibly damaging 0.89
IGL01481:Heatr5a APN 12 51955425 missense probably damaging 1.00
IGL01684:Heatr5a APN 12 51955511 missense probably benign 0.36
IGL01766:Heatr5a APN 12 51889664 missense probably benign 0.15
IGL01799:Heatr5a APN 12 51897835 missense probably benign 0.17
IGL02007:Heatr5a APN 12 51916158 missense probably damaging 1.00
IGL02093:Heatr5a APN 12 51916075 missense possibly damaging 0.68
IGL02205:Heatr5a APN 12 51877337 missense probably damaging 1.00
IGL02450:Heatr5a APN 12 51945430 missense probably benign 0.02
IGL02565:Heatr5a APN 12 51951099 missense possibly damaging 0.54
IGL02707:Heatr5a APN 12 51921366 missense probably benign 0.01
IGL02735:Heatr5a APN 12 51915021 missense probably damaging 0.99
IGL03160:Heatr5a APN 12 51884496 splice site probably benign
F5770:Heatr5a UTSW 12 51881278 splice site probably benign
R0034:Heatr5a UTSW 12 51925172 missense probably damaging 1.00
R0127:Heatr5a UTSW 12 51925405 missense probably benign
R0184:Heatr5a UTSW 12 51909969 missense probably benign 0.00
R0362:Heatr5a UTSW 12 51888861 missense probably damaging 1.00
R0567:Heatr5a UTSW 12 51910089 missense probably damaging 1.00
R0591:Heatr5a UTSW 12 51910101 splice site probably benign
R0736:Heatr5a UTSW 12 51896561 critical splice donor site probably null
R1532:Heatr5a UTSW 12 51952518 missense probably damaging 0.99
R1914:Heatr5a UTSW 12 51905467 missense probably damaging 1.00
R1956:Heatr5a UTSW 12 51945419 critical splice donor site probably null
R1978:Heatr5a UTSW 12 51939658 missense possibly damaging 0.77
R2044:Heatr5a UTSW 12 51955403 missense probably benign 0.19
R2263:Heatr5a UTSW 12 51916150 missense probably damaging 0.97
R2265:Heatr5a UTSW 12 51893745 missense possibly damaging 0.68
R2267:Heatr5a UTSW 12 51893745 missense possibly damaging 0.68
R2268:Heatr5a UTSW 12 51893745 missense possibly damaging 0.68
R2269:Heatr5a UTSW 12 51893745 missense possibly damaging 0.68
R2842:Heatr5a UTSW 12 51955478 missense probably null 1.00
R2842:Heatr5a UTSW 12 51955477 splice site probably null
R3033:Heatr5a UTSW 12 51951038 nonsense probably null
R4303:Heatr5a UTSW 12 51956225 missense probably benign 0.01
R4675:Heatr5a UTSW 12 51877347 missense probably benign 0.17
R4718:Heatr5a UTSW 12 51916163 missense possibly damaging 0.95
R4807:Heatr5a UTSW 12 51877520 missense probably damaging 1.00
R5114:Heatr5a UTSW 12 51956237 nonsense probably null
R5229:Heatr5a UTSW 12 51947978 missense probably benign 0.33
R5411:Heatr5a UTSW 12 51888243 missense probably damaging 1.00
R5548:Heatr5a UTSW 12 51958951 nonsense probably null
R5603:Heatr5a UTSW 12 51877575 missense probably benign 0.26
R5631:Heatr5a UTSW 12 51955527 missense probably benign 0.22
R5742:Heatr5a UTSW 12 51955552 nonsense probably null
R5969:Heatr5a UTSW 12 51959040 missense probably benign
R6020:Heatr5a UTSW 12 51884327 missense probably benign 0.01
R6234:Heatr5a UTSW 12 51877454 missense possibly damaging 0.69
R6352:Heatr5a UTSW 12 51951166 missense possibly damaging 0.88
R6798:Heatr5a UTSW 12 51881265 missense probably benign 0.01
R6815:Heatr5a UTSW 12 51955508 missense possibly damaging 0.89
R7059:Heatr5a UTSW 12 51888234 missense probably damaging 0.98
R7143:Heatr5a UTSW 12 51961468 missense probably benign 0.09
R7178:Heatr5a UTSW 12 51925142 missense probably damaging 0.99
R7291:Heatr5a UTSW 12 51925339 missense probably damaging 0.97
R7454:Heatr5a UTSW 12 51961543 missense probably benign 0.20
R7511:Heatr5a UTSW 12 51879434 missense possibly damaging 0.94
R7636:Heatr5a UTSW 12 51888196 missense probably damaging 1.00
R7636:Heatr5a UTSW 12 51952558 missense probably damaging 1.00
R7665:Heatr5a UTSW 12 51961530 missense probably damaging 1.00
R8088:Heatr5a UTSW 12 51947996 missense possibly damaging 0.85
R8205:Heatr5a UTSW 12 51959009 missense probably benign 0.05
R8212:Heatr5a UTSW 12 51899229 missense probably benign 0.00
R8213:Heatr5a UTSW 12 51891443 missense probably damaging 0.96
R8323:Heatr5a UTSW 12 51955506 missense probably benign 0.02
R8339:Heatr5a UTSW 12 51887919 critical splice donor site probably benign
R8395:Heatr5a UTSW 12 51916178 missense
R8410:Heatr5a UTSW 12 51938120 missense probably benign 0.01
R8676:Heatr5a UTSW 12 51887919 critical splice donor site probably benign
R8834:Heatr5a UTSW 12 51909956 critical splice donor site probably null
R8916:Heatr5a UTSW 12 51887919 critical splice donor site probably benign
V7732:Heatr5a UTSW 12 51905324 missense possibly damaging 0.65
Z1088:Heatr5a UTSW 12 51891404 missense probably damaging 1.00
Z1088:Heatr5a UTSW 12 51951076 missense probably benign 0.29
Predicted Primers PCR Primer
(F):5'- TTCTTCTAGGACAGTGGCTGGC -3'
(R):5'- AAAGCCGAAGACCCTGTTG -3'

Sequencing Primer
(F):5'- CCCACTGTGGACTGTATATCAGG -3'
(R):5'- CCGAAGACCCTGTTGGAGGAG -3'
Posted On2020-09-02