Incidental Mutation 'R8359:Olfr328'
ID645928
Institutional Source Beutler Lab
Gene Symbol Olfr328
Ensembl Gene ENSMUSG00000057654
Gene Nameolfactory receptor 328
SynonymsMOR275-2, GA_x6K02T2NKPP-873285-874217
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.068) question?
Stock #R8359 (G1)
Quality Score225.009
Status Not validated
Chromosome11
Chromosomal Location58550854-58555636 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) G to T at 58552203 bp
ZygosityHeterozygous
Amino Acid Change Threonine to Asparagine at position 12 (T12N)
Ref Sequence ENSEMBL: ENSMUSP00000104452 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000073933] [ENSMUST00000108824] [ENSMUST00000215717] [ENSMUST00000216725]
Predicted Effect probably benign
Transcript: ENSMUST00000073933
AA Change: T12N

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
SMART Domains Protein: ENSMUSP00000073588
Gene: ENSMUSG00000057654
AA Change: T12N

DomainStartEndE-ValueType
Pfam:7TM_GPCR_Srsx 34 303 8.3e-6 PFAM
Pfam:7tm_1 40 289 1.4e-34 PFAM
Pfam:7tm_4 138 282 4.4e-42 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000108824
AA Change: T12N

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
SMART Domains Protein: ENSMUSP00000104452
Gene: ENSMUSG00000057654
AA Change: T12N

DomainStartEndE-ValueType
Pfam:7tm_4 30 306 7e-45 PFAM
Pfam:7TM_GPCR_Srsx 34 303 8.3e-6 PFAM
Pfam:7tm_1 40 289 9.8e-28 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000215717
AA Change: T12N

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
Predicted Effect probably benign
Transcript: ENSMUST00000216725
AA Change: T12N

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.7%
  • 20x: 99.0%
Validation Efficiency
MGI Phenotype FUNCTION: Olfactory receptors interact with odorant molecules in the nose, to initiate a neuronal response that triggers the perception of a smell. The olfactory receptor proteins are members of a large family of G-protein-coupled receptors (GPCR) arising from single coding-exon genes. Olfactory receptors share a 7-transmembrane domain structure with many neurotransmitter and hormone receptors and are responsible for the recognition and G protein-mediated transduction of odorant signals. The olfactory receptor gene family is the largest in the genome. The nomenclature assigned to the olfactory receptor genes and proteins for this organism is independent of other organisms. [provided by RefSeq, Jul 2008]
Allele List at MGI
Other mutations in this stock
Total: 53 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Adam5 A T 8: 24,806,486 V315D probably damaging Het
Adgrf1 A T 17: 43,310,395 I508F probably damaging Het
Atpaf2 T C 11: 60,407,303 D147G probably damaging Het
Brwd1 T C 16: 96,016,209 T1368A probably damaging Het
Cacna1s A T 1: 136,116,061 E1626V probably benign Het
Carm1 G A 9: 21,569,469 V80I possibly damaging Het
Casc4 A T 2: 121,867,151 probably benign Het
Cenpw T A 10: 30,198,488 D71V probably damaging Het
Ckmt1 A T 2: 121,363,050 T364S probably benign Het
Col6a4 T C 9: 106,068,384 S844G probably benign Het
Crybg1 T C 10: 43,992,542 E1380G probably benign Het
Cyp21a1 A G 17: 34,802,131 probably null Het
D430042O09Rik T C 7: 125,868,851 probably null Het
Dhodh A C 8: 109,606,406 D12E probably benign Het
Dnali1 T A 4: 125,063,667 T95S probably damaging Het
Dynlrb1 A G 2: 155,249,950 N93D probably benign Het
Edem1 C T 6: 108,846,813 A390V probably benign Het
Enthd1 T C 15: 80,474,155 D388G probably benign Het
Fam170a A G 18: 50,281,610 T108A probably damaging Het
Fryl A G 5: 73,075,933 S1531P probably benign Het
Hspbap1 C A 16: 35,824,996 N350K probably benign Het
Htr3b A C 9: 48,947,296 S94R probably damaging Het
Ide A T 19: 37,330,487 V42E Het
Igf2r A G 17: 12,683,861 V2434A probably benign Het
Kif16b G A 2: 142,711,857 A1007V probably benign Het
Mccc1 C T 3: 35,964,344 V614I probably benign Het
Mos A G 4: 3,871,097 Y240H probably damaging Het
Myh11 C T 16: 14,208,231 probably null Het
Nexn T A 3: 152,248,361 D166V probably damaging Het
Olfr510 T A 7: 108,668,311 N298K probably benign Het
Olfr55 G A 17: 33,176,921 C173Y probably damaging Het
Pkp4 A G 2: 59,350,551 Y1061C probably damaging Het
Pla2g6 T C 15: 79,287,170 D740G probably damaging Het
Pla2r1 T A 2: 60,443,283 I920L probably benign Het
Plekha2 A G 8: 25,088,391 I31T probably damaging Het
Ppp1r16b G T 2: 158,761,375 V407L probably benign Het
Prss50 A G 9: 110,862,302 I225V probably damaging Het
Rmdn2 A T 17: 79,628,151 E231V Het
Sema3c T C 5: 17,653,728 S42P possibly damaging Het
Slc22a20 T C 19: 5,971,526 I483V probably benign Het
Slc30a2 T C 4: 134,349,379 V275A probably damaging Het
Slc6a3 T A 13: 73,544,883 F207L probably benign Het
Slc9a1 A T 4: 133,420,616 Q648H probably damaging Het
Slpi A T 2: 164,356,055 M1K probably null Het
Smc5 A C 19: 23,234,079 S564A possibly damaging Het
Smchd1 A T 17: 71,431,243 F542L probably damaging Het
Sycp1 T A 3: 102,820,593 K901N probably damaging Het
Synpo2l T A 14: 20,666,140 T126S probably benign Het
Upp2 A G 2: 58,777,943 N216S probably benign Het
Wnk1 T C 6: 119,992,447 D349G probably damaging Het
Zfp180 C T 7: 24,104,912 A252V probably benign Het
Zfr2 C T 10: 81,242,819 T295I possibly damaging Het
Zkscan16 C T 4: 58,957,230 T504I possibly damaging Het
Other mutations in Olfr328
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01950:Olfr328 APN 11 58551734 nonsense probably null
IGL02887:Olfr328 APN 11 58552161 missense probably damaging 1.00
IGL03409:Olfr328 APN 11 58551562 missense probably benign 0.01
P4748:Olfr328 UTSW 11 58551522 missense probably damaging 1.00
R0504:Olfr328 UTSW 11 58551636 missense probably damaging 1.00
R1637:Olfr328 UTSW 11 58551420 missense possibly damaging 0.64
R1863:Olfr328 UTSW 11 58552023 missense probably benign 0.04
R2158:Olfr328 UTSW 11 58551942 missense probably damaging 1.00
R2404:Olfr328 UTSW 11 58551720 missense probably damaging 1.00
R4024:Olfr328 UTSW 11 58551396 missense possibly damaging 0.90
R4073:Olfr328 UTSW 11 58552062 missense probably damaging 1.00
R5261:Olfr328 UTSW 11 58552051 missense probably benign 0.01
R5399:Olfr328 UTSW 11 58552143 missense probably benign 0.20
R6053:Olfr328 UTSW 11 58552066 missense possibly damaging 0.90
R6411:Olfr328 UTSW 11 58551657 missense probably damaging 0.99
R6709:Olfr328 UTSW 11 58552036 missense probably benign 0.01
R7243:Olfr328 UTSW 11 58551401 missense probably damaging 1.00
R7540:Olfr328 UTSW 11 58551631 missense possibly damaging 0.96
Predicted Primers PCR Primer
(F):5'- AGCATCTTGGGCACAGTGAC -3'
(R):5'- TGATGACTGCAACCACACATG -3'

Sequencing Primer
(F):5'- CAGTGACAGAAATGTACATCATGTCC -3'
(R):5'- TGACTGCAACCACACATGTAAATTC -3'
Posted On2020-09-02