Incidental Mutation 'R8365:Foxn3'
ID646151
Institutional Source Beutler Lab
Gene Symbol Foxn3
Ensembl Gene ENSMUSG00000033713
Gene Nameforkhead box N3
SynonymsHTLFL1, Ches1l, Ches1, 5430426H20Rik
MMRRC Submission
Accession Numbers
Is this an essential gene? Probably essential (E-score: 0.789) question?
Stock #R8365 (G1)
Quality Score225.009
Status Not validated
Chromosome12
Chromosomal Location99190078-99563582 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 99341468 bp
ZygosityHeterozygous
Amino Acid Change Lysine to Glutamic Acid at position 204 (K204E)
Ref Sequence ENSEMBL: ENSMUSP00000036035 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000046859] [ENSMUST00000085108] [ENSMUST00000177269] [ENSMUST00000177451]
Predicted Effect probably damaging
Transcript: ENSMUST00000046859
AA Change: K204E

PolyPhen 2 Score 0.961 (Sensitivity: 0.78; Specificity: 0.95)
SMART Domains Protein: ENSMUSP00000036035
Gene: ENSMUSG00000033713
AA Change: K204E

DomainStartEndE-ValueType
low complexity region 8 23 N/A INTRINSIC
FH 112 204 2.48e-51 SMART
low complexity region 308 331 N/A INTRINSIC
low complexity region 342 363 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000085108
AA Change: K204E

PolyPhen 2 Score 0.961 (Sensitivity: 0.78; Specificity: 0.95)
SMART Domains Protein: ENSMUSP00000082189
Gene: ENSMUSG00000033713
AA Change: K204E

DomainStartEndE-ValueType
low complexity region 8 23 N/A INTRINSIC
FH 112 204 2.48e-51 SMART
low complexity region 308 331 N/A INTRINSIC
low complexity region 342 363 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000177269
SMART Domains Protein: ENSMUSP00000135814
Gene: ENSMUSG00000033713

DomainStartEndE-ValueType
low complexity region 8 23 N/A INTRINSIC
FH 112 191 8.41e-40 SMART
Predicted Effect probably damaging
Transcript: ENSMUST00000177451
AA Change: K204E

PolyPhen 2 Score 0.961 (Sensitivity: 0.78; Specificity: 0.95)
SMART Domains Protein: ENSMUSP00000135082
Gene: ENSMUSG00000033713
AA Change: K204E

DomainStartEndE-ValueType
low complexity region 8 23 N/A INTRINSIC
FH 112 204 2.48e-51 SMART
low complexity region 308 331 N/A INTRINSIC
low complexity region 342 363 N/A INTRINSIC
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.7%
  • 20x: 99.0%
Validation Efficiency
MGI Phenotype PHENOTYPE: Hypomorphic homozygous knockout affects the expression of osteogenic genes and leads to craniofacial abnormalities and reduces pre- and postnatal survival. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 39 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4931417E11Rik A T 6: 73,469,346 N73K probably benign Het
A2ml1 A T 6: 128,580,955 C79* probably null Het
Abcc9 A T 6: 142,599,072 S1430T probably benign Het
Akap9 C G 5: 3,968,745 H1109D probably benign Het
Ankrd17 T C 5: 90,250,519 K1724R possibly damaging Het
Brf2 A G 8: 27,128,538 S13P possibly damaging Het
Cfap46 T A 7: 139,683,084 K18* probably null Het
Cym T G 3: 107,212,866 I306L probably benign Het
Cyp2c66 A T 19: 39,176,604 H343L probably benign Het
Cyp2d34 T C 15: 82,620,673 Y62C probably damaging Het
D630045J12Rik A G 6: 38,195,635 S533P probably benign Het
Dnajc10 A G 2: 80,346,558 Y619C probably damaging Het
Dnal1 T A 12: 84,131,389 probably null Het
Eif4g1 T A 16: 20,683,527 M914K probably damaging Het
Epb41l2 C A 10: 25,441,686 Q34K probably benign Het
Esyt1 T G 10: 128,516,553 N730H possibly damaging Het
Fbxo15 T G 18: 84,962,614 I238S probably damaging Het
Gtf2i G A 5: 134,274,580 S279L probably benign Het
Hhatl A G 9: 121,789,865 M67T probably damaging Het
Itpkc C A 7: 27,212,352 R598L probably damaging Het
Kctd18 A T 1: 57,959,152 I263N probably damaging Het
Map1a T A 2: 121,308,047 M3002K probably damaging Het
Med13l T A 5: 118,728,644 S588T possibly damaging Het
Pcdh8 T A 14: 79,770,986 I46F probably damaging Het
Prdm6 T C 18: 53,552,065 V392A probably benign Het
Ptprt T A 2: 161,901,531 I497F probably benign Het
Rorc A G 3: 94,375,059 H22R probably benign Het
Scaf8 A G 17: 3,195,966 I777V possibly damaging Het
Shroom1 A T 11: 53,465,641 R444* probably null Het
Srcap C T 7: 127,549,697 T2030I probably damaging Het
Srgap3 A G 6: 112,816,734 S94P probably damaging Het
Srsf12 C G 4: 33,226,070 P111R probably damaging Het
Ssfa2 T C 2: 79,662,345 S1079P probably damaging Het
Ttc27 C T 17: 74,747,674 T325I probably damaging Het
Ucp1 A C 8: 83,293,999 H146P probably damaging Het
Vmn1r167 A T 7: 23,504,775 I272N probably benign Het
Vmn2r1 T C 3: 64,086,613 S127P possibly damaging Het
Vtcn1 A G 3: 100,883,829 D61G probably benign Het
Zfp994 A T 17: 22,201,246 C241S probably damaging Het
Other mutations in Foxn3
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00715:Foxn3 APN 12 99196607 missense possibly damaging 0.90
R0521:Foxn3 UTSW 12 99209506 missense probably benign 0.00
R2248:Foxn3 UTSW 12 99196556 missense probably benign 0.08
R4094:Foxn3 UTSW 12 99196441 missense probably damaging 1.00
R4095:Foxn3 UTSW 12 99196441 missense probably damaging 1.00
R5276:Foxn3 UTSW 12 99196428 nonsense probably null
R6207:Foxn3 UTSW 12 99196310 missense probably damaging 1.00
R6270:Foxn3 UTSW 12 99388417 missense probably damaging 1.00
R6364:Foxn3 UTSW 12 99388693 missense probably benign 0.42
R6379:Foxn3 UTSW 12 99196278 missense probably benign
R7443:Foxn3 UTSW 12 99388779 missense possibly damaging 0.61
R7741:Foxn3 UTSW 12 99196328 missense probably damaging 1.00
R8021:Foxn3 UTSW 12 99388902 start codon destroyed probably null 0.99
R8390:Foxn3 UTSW 12 99388741 missense probably benign 0.00
Z1177:Foxn3 UTSW 12 99388597 missense probably benign
Predicted Primers PCR Primer
(F):5'- GATGTGCCTCCTCATCAGAC -3'
(R):5'- GTCAGCCTGAGAAATCATTAGC -3'

Sequencing Primer
(F):5'- ATGTGCCTCCTCATCAGACTTAATTC -3'
(R):5'- CAGCCTGAGAAATCATTAGCAAATG -3'
Posted On2020-09-02